ID: 1017118308 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:150999936-150999958 |
| Sequence | CAGAACATGAGGAAGTTACT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4212 | |||
| Summary | {0: 1, 1: 0, 2: 14, 3: 3417, 4: 780} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017118308_1017118314 | 17 | Left | 1017118308 | 6:150999936-150999958 | CCCAGTAACTTCCTCATGTTCTG | 0: 1 1: 0 2: 14 3: 3417 4: 780 |
||
| Right | 1017118314 | 6:150999976-150999998 | TCCCCTAATGTGTATGAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017118308 | Original CRISPR | CAGAACATGAGGAAGTTACT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||