ID: 1017118308

View in Genome Browser
Species Human (GRCh38)
Location 6:150999936-150999958
Sequence CAGAACATGAGGAAGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4212
Summary {0: 1, 1: 0, 2: 14, 3: 3417, 4: 780}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017118308_1017118314 17 Left 1017118308 6:150999936-150999958 CCCAGTAACTTCCTCATGTTCTG 0: 1
1: 0
2: 14
3: 3417
4: 780
Right 1017118314 6:150999976-150999998 TCCCCTAATGTGTATGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017118308 Original CRISPR CAGAACATGAGGAAGTTACT GGG (reversed) Intronic
Too many off-targets to display for this crispr