ID: 1017121452

View in Genome Browser
Species Human (GRCh38)
Location 6:151028079-151028101
Sequence AGGGCTGTGTGCTTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 362}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017121452_1017121463 12 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121463 6:151028114-151028136 GGAAGCAGGGCCGCCCAGTTGGG No data
1017121452_1017121457 -9 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121457 6:151028093-151028115 CACAGCCCTGGGTTGAGGCAGGG No data
1017121452_1017121461 -1 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121461 6:151028101-151028123 TGGGTTGAGGCAGGGAAGCAGGG 0: 1
1: 0
2: 5
3: 49
4: 626
1017121452_1017121456 -10 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121456 6:151028092-151028114 ACACAGCCCTGGGTTGAGGCAGG 0: 1
1: 0
2: 2
3: 43
4: 293
1017121452_1017121462 11 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121462 6:151028113-151028135 GGGAAGCAGGGCCGCCCAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 195
1017121452_1017121467 30 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121467 6:151028132-151028154 TTGGGATTCATTCGTACTACTGG 0: 1
1: 0
2: 1
3: 2
4: 49
1017121452_1017121460 -2 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017121452 Original CRISPR AGGGCTGTGTGCTTCCCAGC AGG (reversed) Intronic
900581013 1:3409278-3409300 AGGGCTGAGTGCCTCCCCGAGGG + Intronic
900604472 1:3517643-3517665 TGGGCTGTGTGTTTTGCAGCTGG - Intronic
901814873 1:11788285-11788307 CGGGCTGCGGGGTTCCCAGCAGG + Exonic
902658714 1:17886951-17886973 AGGCCTGTGTCCCTCCCAGCTGG - Intergenic
902839345 1:19065362-19065384 AGGACGGGGTGGTTCCCAGCCGG + Intergenic
903571909 1:24311895-24311917 TGGGTTCTGTTCTTCCCAGCAGG + Intergenic
904619595 1:31767270-31767292 AGGGCTGTCTGCCTTCCAACTGG - Intergenic
904793819 1:33043902-33043924 AGGGCTGGCATCTTCCCAGCTGG - Intronic
905245208 1:36608086-36608108 TGGGCTGTTTTCTTCCCAGTGGG - Intergenic
905267442 1:36764625-36764647 AGGGCTGTGTCCTTTCCAGAAGG + Intergenic
905295897 1:36954185-36954207 AGGGGTGAGAGCTTCCCAACAGG - Intronic
906826973 1:48992545-48992567 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
906851179 1:49251648-49251670 AGGGGTGCCTGCTTCCCTGCAGG - Intronic
906947852 1:50310759-50310781 AAGGCAGTCTGCTACCCAGCAGG - Intergenic
908041453 1:60118313-60118335 AGGGCTGGGTGTTTGGCAGCAGG + Intergenic
909270402 1:73617053-73617075 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
909420721 1:75461967-75461989 AGGCCTGCGTCCTTCCCTGCAGG - Intronic
910229954 1:84975119-84975141 AGGCCTGTGTTCTTCCCTCCAGG - Intronic
910451655 1:87352785-87352807 AGAACTGTGTGCTTTCCAGAAGG + Intergenic
911239304 1:95448463-95448485 AGGGTTGTGTGCTTCCCTTCAGG + Intergenic
911557202 1:99359561-99359583 AGGCATGGGTGCTTCCCAGCTGG - Intergenic
911826137 1:102486783-102486805 AGTCCTGTGTCCTTCCCTGCAGG - Intergenic
912475770 1:109933848-109933870 AGAGCTGGGTGCTTCCCACAGGG + Intergenic
913445805 1:118949588-118949610 AAGGCTGGGTGCTCCCCAGCTGG - Intronic
915674474 1:157517616-157517638 AGGGCTGTGTTCCTCCCTGGAGG - Intronic
917306141 1:173627589-173627611 TGGGCTGTGTGCTTCCCCTCTGG - Intronic
919797493 1:201330085-201330107 AGGCCTGAGGGCTTCTCAGCTGG - Exonic
919895205 1:202005430-202005452 AGGGATGTGGGCATCACAGCTGG - Intronic
920421560 1:205837804-205837826 AGGGCTGTTTTCCACCCAGCTGG - Intronic
920917036 1:210266162-210266184 AAGTCTGTGTGCTTTCCCGCCGG + Intergenic
921065630 1:211620530-211620552 AAGGCTGGGTGCCTCCCTGCTGG - Intergenic
921994078 1:221397700-221397722 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
922685390 1:227634796-227634818 AGGCCTGTGTTCTTCCCTTCAGG - Intronic
923623325 1:235595066-235595088 CGTGCTGTGTGCTTCCCTGTGGG - Intronic
923719079 1:236451958-236451980 AGGCCTGCGTGCTTTCCAGAAGG + Intronic
1062871772 10:910841-910863 AGGGCTGTGTGCTTTTCAGTAGG - Intronic
1063096775 10:2915558-2915580 AGTGCTGCCCGCTTCCCAGCTGG + Intergenic
1063310961 10:4951293-4951315 AGGGCTGTGTCCTTCAGATCTGG - Intronic
1063316841 10:5015085-5015107 AGGGCTGTGTCCTTCAGATCTGG + Intronic
1064162931 10:12961133-12961155 AGGTCTGTGGAATTCCCAGCCGG - Intronic
1064995606 10:21294397-21294419 AGGACTGTGCGTTTCCAAGCAGG + Intergenic
1066034590 10:31468498-31468520 AGAGCTGTGTACTTGTCAGCAGG - Intronic
1069863688 10:71486982-71487004 AGGGTTGTGTCCCTCCCAGTGGG - Intronic
1069988451 10:72299429-72299451 AGGGCTGTGTGCTCCACAGTTGG + Intergenic
1070721619 10:78760975-78760997 TGGTCTGTCTGCTTCCCGGCTGG + Intergenic
1071494082 10:86155816-86155838 TGGGCTGTGTGCTTGCCTCCAGG + Intronic
1071728563 10:88224229-88224251 AGGGCTCTCTGCTTCACAGATGG + Intergenic
1072753659 10:98002489-98002511 AGACCTCTGTGATTCCCAGCTGG + Intronic
1072758685 10:98038364-98038386 AGCGCTATTTGCTTTCCAGCAGG + Intergenic
1073073752 10:100810548-100810570 AGGTCAGAGAGCTTCCCAGCTGG - Intronic
1074611975 10:115030572-115030594 AGGGCAGAGCTCTTCCCAGCTGG - Intergenic
1074638029 10:115344193-115344215 AGGCCTGTGTTCTTCCCTTCTGG + Intronic
1076107399 10:127834544-127834566 TGGGCTGTATGCTTCCCATGGGG - Intergenic
1076189438 10:128472586-128472608 AGGGCTGTGGTCTTCCCTGTTGG + Intergenic
1076670434 10:132117974-132117996 AGGGCTCAGTGTTTCGCAGCAGG + Intronic
1076889876 10:133278187-133278209 AGGGAAGTGTGATTGCCAGCTGG - Intergenic
1077493509 11:2873388-2873410 AGGGCTCTCTGCTTCCAAGATGG + Intergenic
1077550903 11:3199864-3199886 AGGGCTGTTTGCTCTCCAGGTGG + Intergenic
1078586811 11:12598992-12599014 AGGGCTGTTTGCCTTCCACCAGG - Intergenic
1079183591 11:18215583-18215605 AGGCCTGTGTCCTTCCCTTCAGG - Intronic
1079571947 11:21953605-21953627 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1081011076 11:37812699-37812721 GGGGCTAGGGGCTTCCCAGCTGG + Intergenic
1081112138 11:39149312-39149334 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
1081773235 11:45662446-45662468 ATGGCTGGCTGCTTCCCAGCGGG + Intronic
1082816687 11:57514247-57514269 AGAGCCCTGGGCTTCCCAGCCGG + Intronic
1082953870 11:58847766-58847788 AGGCCTGTGTGCTTCCCATCAGG - Intronic
1082970286 11:59013019-59013041 AGGCCTGTGTCCTTCCCATCAGG - Intronic
1083779413 11:64910223-64910245 AGGGCTGAGTGGTACTCAGCGGG + Intronic
1083858357 11:65405009-65405031 AGGGCAGTGTGGTGTCCAGCCGG + Exonic
1084930247 11:72549589-72549611 AGGGCTGAGGGATTTCCAGCAGG + Intergenic
1085388515 11:76170651-76170673 AGGGCTTGGTGTTTTCCAGCTGG + Intergenic
1085449557 11:76623721-76623743 AGGGCTGGGTGTTACTCAGCAGG + Intergenic
1085981571 11:81732693-81732715 AGGCCTGTGTTCTTCCCTTCAGG + Intergenic
1086068842 11:82776438-82776460 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
1087877024 11:103370403-103370425 AGGCCTGTGTCCTTCCCTTCAGG - Intronic
1088052988 11:105541399-105541421 AAGGCTGTGTGACTCCCAGAAGG + Intergenic
1090198612 11:124838585-124838607 AGGGCTGTGTCCACCCCACCTGG + Intergenic
1091138688 11:133217089-133217111 AGGGCTGAGTTCTTCCCAAGAGG - Intronic
1091756398 12:3055118-3055140 AGGGAAATGTGCTTGCCAGCTGG + Intergenic
1091765864 12:3119597-3119619 AGGGCTGTGTGCTTCACTGGAGG + Intronic
1093991203 12:25591593-25591615 AGGCCTGTGTCCTTCCCTTCAGG - Intronic
1093994404 12:25625863-25625885 AGGGCTGTGTACAGCCCAGGTGG - Intronic
1095227620 12:39695684-39695706 AGGCCTGTGTCCTTCCCTTCAGG - Intronic
1096372902 12:51083490-51083512 AGGGCGGTGGGCAGCCCAGCCGG + Exonic
1097473159 12:60021211-60021233 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1098152341 12:67559723-67559745 TGGACTGTGTTCTTCCCCGCTGG - Intergenic
1098207831 12:68132163-68132185 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1100717572 12:97322092-97322114 AGGGCTGTGTGTGTCCTACCAGG + Intergenic
1101759322 12:107645958-107645980 AGGGCTGAATGCGACCCAGCAGG + Intronic
1103417459 12:120752612-120752634 AGGGCTCTGTCCTGTCCAGCTGG + Intergenic
1104152417 12:126096324-126096346 AGTGCTGTGAGCCTGCCAGCTGG - Intergenic
1104505218 12:129325572-129325594 AGGACTGTGGGCTTGGCAGCTGG + Intronic
1105336307 13:19473271-19473293 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
1106414444 13:29534658-29534680 AGGGCTGCGAGGATCCCAGCAGG + Intronic
1106607355 13:31241448-31241470 AGTGGTGTGTGATGCCCAGCAGG + Intronic
1107552126 13:41487165-41487187 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1109987992 13:70016251-70016273 AGGGCTGTGTGCTCCAGAGCTGG + Intronic
1110441079 13:75525663-75525685 ACAGCTGTGTGCTACCTAGCAGG + Intronic
1110916768 13:81030753-81030775 AGGACTGTGTTCTTCCCATCAGG + Intergenic
1112608095 13:100927809-100927831 AGGGCTGTCTGCTTCCTAGATGG + Intergenic
1113078579 13:106492679-106492701 AGGGCTGTGAGCATCCTGGCAGG - Exonic
1114688057 14:24553888-24553910 AGGCCTATGTGCTTCCCTTCAGG + Intergenic
1115620251 14:35134043-35134065 AGGCCTGTGTTCTTCCCTTCAGG + Intronic
1116504760 14:45664966-45664988 AGGCCTGTGTGCTTCCTTTCAGG + Intergenic
1116930661 14:50687947-50687969 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1119294590 14:73522664-73522686 AGGGCGGGGTGCTTCCCGGACGG + Exonic
1121088503 14:91164904-91164926 AGGCCTGTGTCCTTCCCTGCAGG + Intronic
1121088663 14:91166308-91166330 AGGCCTGTGTCCTTCCCTGCAGG + Intronic
1121112364 14:91321078-91321100 AGGGTTCTGTGCTTCCCCGGTGG + Intronic
1121264233 14:92588861-92588883 AGGGCAGTGTGCATCTTAGCAGG + Intronic
1121472494 14:94166124-94166146 AGGGCACTGTGCTGCCCACCAGG - Intronic
1121541876 14:94733843-94733865 AGAGCTGGGTGCTTCCCTCCAGG - Intergenic
1122123593 14:99567456-99567478 AAGGCTGTGTTCTCACCAGCAGG + Intronic
1122787546 14:104170954-104170976 AGGGCTGCCTGGTTCCCTGCTGG + Intronic
1124554874 15:30715865-30715887 AGGGGACTGTGCTTCTCAGCGGG - Intronic
1124676373 15:31689815-31689837 AGGGGACTGTGCTTCTCAGCGGG + Intronic
1126325634 15:47473962-47473984 AAGGCTGTGCCTTTCCCAGCTGG + Intronic
1126517540 15:49553491-49553513 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
1127672291 15:61206727-61206749 AGGGCTGTGTGCTGCCGGGCTGG - Intronic
1127957393 15:63864831-63864853 AAGGCTGGGTGCTTCCCAGCAGG - Intergenic
1128925836 15:71654926-71654948 AGGCCTCTGTCCTTCACAGCAGG - Intronic
1129689072 15:77703081-77703103 AGAGCAGTTTGCTTCACAGCTGG - Intronic
1129742380 15:77995746-77995768 AGGCCTTTGGGTTTCCCAGCTGG + Exonic
1129843103 15:78755731-78755753 AGGCCTTTGGGTTTCCCAGCTGG - Intergenic
1129984423 15:79904865-79904887 AGGTCTGTCTGCTTCCAAGTTGG + Intronic
1131816643 15:96228237-96228259 AATGCTGTGTGTTTCCCAGATGG + Intergenic
1131959335 15:97772714-97772736 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1132738255 16:1397873-1397895 AGGGGTGTCTGCCTCCCACCAGG + Intronic
1134014162 16:10877220-10877242 GAGGCTGTGTGCTTCTGAGCTGG + Exonic
1134694428 16:16212679-16212701 TGAGCTTGGTGCTTCCCAGCAGG + Intronic
1134977405 16:18581951-18581973 TGAGCTTGGTGCTTCCCAGCAGG - Intergenic
1135741407 16:24978417-24978439 AGGGGGCTGTGCATCCCAGCGGG - Intronic
1136368608 16:29821556-29821578 GGGGCTGTGTACTGCCCAGATGG - Intronic
1137568374 16:49548679-49548701 AAGGCTTTGTGCTTCCCCGAAGG - Intronic
1137699813 16:50489396-50489418 AGGGCTGCCTGCTTGCCACCAGG - Intergenic
1138647281 16:58434607-58434629 AGGGATGTGTGCTTGTCAGGGGG - Intergenic
1138665858 16:58567770-58567792 AGGGCTGTCAGCTTCTAAGCTGG - Intronic
1139482791 16:67239957-67239979 AGGGCTGTGAGCTTCCTCGAAGG - Intronic
1140137530 16:72220812-72220834 AGGGATGTGTTCTTACCATCTGG - Intergenic
1141134268 16:81455622-81455644 AAGGCTGTGTGCACCACAGCTGG - Intronic
1141616303 16:85211632-85211654 GGAGCTGTGTGGTTCCCATCTGG + Intergenic
1142283213 16:89160245-89160267 GGGGCTGTGGGGTGCCCAGCAGG - Intergenic
1142288124 16:89179714-89179736 AGGGCTCTGGGCTTCCAACCTGG + Intronic
1144073368 17:11694482-11694504 AGGGCTGAGGGGTGCCCAGCAGG + Intronic
1144100461 17:11937941-11937963 AGGACTGTGTTCTTCCCCACTGG - Intronic
1146448748 17:32954774-32954796 GGGGCTGAGTGCCGCCCAGCTGG + Intergenic
1146833397 17:36089680-36089702 AGGGCTGCTTACTTCCCAGTGGG - Intronic
1146847929 17:36196288-36196310 AGGGCTGCTTACTTCCCAGTGGG - Intronic
1147904752 17:43815812-43815834 AGGGCAGTGTGCCCCACAGCTGG + Intronic
1148094985 17:45046246-45046268 AGGAAGGTGAGCTTCCCAGCAGG + Intronic
1148466294 17:47867059-47867081 ATGGGTGTGTACGTCCCAGCCGG - Intergenic
1148619315 17:49022521-49022543 AGGGCTGGGTGAGTCCCTGCTGG + Intronic
1150618447 17:66790151-66790173 AAGGCTGTGTGCCACCCAGTTGG - Intronic
1150760865 17:67959685-67959707 AGGCCTGTGTGTTGCACAGCAGG - Exonic
1152207222 17:78980684-78980706 CCGGCTGTGTGGTTCCCAGAGGG + Intergenic
1153523237 18:5971654-5971676 AAAGCTGTGTGCTCCCCAGCAGG + Intronic
1155112215 18:22727199-22727221 AGGGCTGTCTTTCTCCCAGCTGG + Intergenic
1155159638 18:23185271-23185293 AGGAGTCTGTGCTTCCTAGCAGG + Intronic
1155533885 18:26795431-26795453 AGGCCTGTGTCCTTTCCATCAGG - Intergenic
1156025924 18:32655243-32655265 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1157566262 18:48680973-48680995 AGGGCTACGTGCTCTCCAGCAGG + Intronic
1158431371 18:57390166-57390188 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1159525919 18:69588633-69588655 AGGGCTGAGAGATTCCCACCAGG + Intronic
1160157470 18:76444514-76444536 TGTGTTGTGTGCTTCCCAGCCGG - Intronic
1160688684 19:450091-450113 AGGGGTGTGTGCTGCCCTGGGGG + Intronic
1161013047 19:1969329-1969351 TGTGATGTGTGCTTCCCAGCTGG + Intronic
1161216930 19:3099277-3099299 AGGGCTGTGTTCTCCCCACTGGG + Intronic
1161288922 19:3482682-3482704 ACGGCTTTCTCCTTCCCAGCCGG - Intergenic
1161714168 19:5866192-5866214 TGGGCCCTGTGCCTCCCAGCGGG + Exonic
1162041710 19:7974926-7974948 AGGGCAGTGGGCGGCCCAGCAGG + Intronic
1163649992 19:18511688-18511710 AGTGCTGTGGGCTTTCCAGTGGG + Intronic
1164491160 19:28715256-28715278 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1166846400 19:45731093-45731115 AGCGCAGGGTGCTTCCCCGCTGG + Intergenic
1167737629 19:51305996-51306018 AGGGCTGTGTGTGTCCCATATGG + Intergenic
1168106988 19:54171833-54171855 CGGGCTGTGCGGGTCCCAGCTGG + Intronic
1168416875 19:56174912-56174934 GGGGCTGGGTCCTTCCCATCGGG + Intergenic
926794362 2:16606730-16606752 AGGGCCTTTTGCTTCCCAGAAGG - Intronic
927317043 2:21695884-21695906 AGCTCTGTGTTCTTCCCAGATGG + Intergenic
927594650 2:24385976-24385998 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
927873701 2:26640412-26640434 AGGGCTGTGTGGCTCTGAGCAGG + Intronic
928458962 2:31451421-31451443 AGGCCTGTGTCCTTCCCTCCAGG - Intergenic
929884214 2:45863904-45863926 TGGGCCGTCTGCTGCCCAGCAGG - Intronic
931637349 2:64352366-64352388 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
931758661 2:65396798-65396820 AGGGCTGTTTGCATCAGAGCAGG - Intronic
932088757 2:68786173-68786195 AGAGCTGCGTGTTTCCCAGTGGG + Intronic
933200116 2:79438328-79438350 AGGGCTTTGTGCGTTCCAGGTGG - Intronic
934723838 2:96602199-96602221 ATGGCTGTGGGCTTCCCACCAGG + Exonic
935599621 2:104909630-104909652 AGGTCAGGCTGCTTCCCAGCTGG + Intergenic
936083603 2:109451970-109451992 AGGGCAATGTGCTTCTCTGCTGG - Intronic
937966968 2:127519973-127519995 AGGGCTGTGTTCTTCTCTGAGGG - Intronic
938619356 2:133032544-133032566 AGGCCTGTGTTTTTCCCTGCAGG - Intronic
941748425 2:169111050-169111072 ATGGCTGTGAGCTTGCCAGGCGG + Intergenic
942198531 2:173547367-173547389 ATGGCAGTGTGCTTTCCATCTGG + Intergenic
944096038 2:195968806-195968828 TGGGATGGGTGCTTCCCTGCTGG + Intronic
944616307 2:201464672-201464694 AGGGCAGTGAGCTCCCCACCTGG + Intronic
944667714 2:201970982-201971004 AGGGCTCTCTGCTTCACAGATGG - Intergenic
945210311 2:207375664-207375686 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
947009217 2:225547217-225547239 AGGGCAGTGGGCTACCCAGTGGG - Intronic
947992803 2:234499694-234499716 AGGGCTGTCTGCTGTCCAGTAGG + Intergenic
948468375 2:238162852-238162874 CGGGGTGTGTGTGTCCCAGCCGG - Intronic
948478511 2:238236562-238236584 AGGGCTGTCTCCTTCCCACCCGG - Intergenic
948478521 2:238236597-238236619 AGGGCTGTCTCCTTCCCACCCGG - Intergenic
948478531 2:238236632-238236654 AGGGCTGTCTCCTTCCCACCCGG - Intergenic
948976851 2:241468694-241468716 GGGGCTGTGGGGTCCCCAGCAGG - Intronic
1168821062 20:774178-774200 AGGGCTAGGTGCCTACCAGCTGG - Intergenic
1170407771 20:16056890-16056912 AGGGCTCTTTGCTTCCTAGATGG - Intergenic
1170795294 20:19541744-19541766 AGGGAAATGTGCTTCCCAGTTGG + Intronic
1171136234 20:22696966-22696988 CGTGGTGTGTGCTTCCCTGCAGG - Intergenic
1171459964 20:25292740-25292762 AGGGCTGTGTGCCTGCCTGCAGG + Intronic
1172117352 20:32581005-32581027 AGGCCTGTGGGCTGCCAAGCGGG - Intronic
1172240814 20:33411398-33411420 AGGGCTCCGTGCTTGCCAGATGG - Intronic
1172882981 20:38213595-38213617 ACGGCTGCGAGCTTCTCAGCAGG + Exonic
1173845416 20:46185368-46185390 AGGGCAGTTTGCTTTCCAGGTGG + Intronic
1174286256 20:49475821-49475843 TGGGCTGTGTGATCCTCAGCAGG + Intronic
1174513589 20:51074574-51074596 AATGCTGTCTGCTTTCCAGCAGG + Intergenic
1174824686 20:53758677-53758699 AGTGCTGTGTGGTTACCAGGGGG - Intergenic
1175297602 20:57919810-57919832 ACGAATGTGAGCTTCCCAGCTGG - Intergenic
1175634272 20:60567453-60567475 AGGGCCTCCTGCTTCCCAGCTGG + Intergenic
1175967851 20:62668622-62668644 AAGGGGATGTGCTTCCCAGCAGG + Intronic
1175995884 20:62812163-62812185 AGGGCGGGGTGCGGCCCAGCAGG + Intronic
1176363788 21:6020186-6020208 TGGGCTGTGTCCTTCCCTGGAGG + Intergenic
1178216686 21:30606377-30606399 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1178847345 21:36184646-36184668 AGAGCTGTGTGCTTCGCTGCCGG + Intronic
1178923076 21:36752211-36752233 TGTGCTCTGTGCTTTCCAGCAGG - Exonic
1179759730 21:43518359-43518381 TGGGCTGTGTCCTTCCCTGGAGG - Intergenic
1179836483 21:44037920-44037942 AGTGCTGTGTGAGTACCAGCAGG + Exonic
1180011579 21:45054831-45054853 ATGGCTGTTTCCCTCCCAGCGGG - Intergenic
1180039584 21:45268979-45269001 GGGGCTCTTTGCTTCCCAGTAGG - Intronic
1180563247 22:16639367-16639389 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1181096279 22:20507451-20507473 AGGGGCGTGTGTCTCCCAGCCGG + Intronic
1181130573 22:20729243-20729265 AGCGCAGGGTGCTTGCCAGCTGG - Intronic
1181541092 22:23573743-23573765 AGGGCTGTCTGCTCTCCAGAGGG - Intronic
1181797290 22:25319587-25319609 AGGGCTGTCTGCTCTCCAGAGGG + Intergenic
1182772932 22:32808880-32808902 AGGGCTGCGTGCCACCCAGAGGG + Intronic
1182775508 22:32828581-32828603 TGGTCTGTTTGCTTCCCAGTTGG + Intronic
1183048494 22:35241338-35241360 AAGGCTTTCTGCCTCCCAGCTGG + Intergenic
1183214017 22:36467652-36467674 AGCCCTGAGTGCTTCCGAGCTGG - Exonic
1183469301 22:37997162-37997184 AGGGCCCTGAGCTTCCCAGCCGG + Intronic
1183531881 22:38360777-38360799 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
1184052333 22:42017060-42017082 AATGCTGTTTGCTTCCCATCTGG + Intronic
1184333275 22:43839287-43839309 AGGCCTGTGTTCTTACCACCAGG - Intronic
1184513363 22:44945819-44945841 GGGGCTGAGTGCCTCCCAGATGG + Intronic
1185042769 22:48513905-48513927 AGGGCTCTCAGCTACCCAGCAGG + Intronic
1185161830 22:49234634-49234656 TGGGCTGTTTGCCACCCAGCTGG - Intergenic
949373924 3:3365887-3365909 AGTGTTTTGTGCATCCCAGCAGG + Intergenic
949859074 3:8489150-8489172 AGGGCTGTGAGCCTCACTGCAGG + Intergenic
950641864 3:14353653-14353675 AGAGCCCTGTGTTTCCCAGCAGG + Intergenic
951204454 3:19910533-19910555 AGGCCTGTGTCCTTCCCTTCAGG - Intronic
952139747 3:30465681-30465703 AGGCCTGTGTTCTTCCCTTCAGG + Intergenic
952738486 3:36713486-36713508 AGGAGTGGGTGCTGCCCAGCAGG - Exonic
952871135 3:37902443-37902465 GGGTCTCTGTACTTCCCAGCAGG + Intronic
953675257 3:44996124-44996146 AGGGCTGGGTGCCTTCCAGATGG + Intronic
953983878 3:47426823-47426845 TGGCCTGTGTCCTTCCCAGTGGG - Intronic
954487949 3:50872602-50872624 AGGTCTGTGTCCTTCCCTTCAGG + Intronic
954491627 3:50912504-50912526 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
955216489 3:56988598-56988620 AGGGCACTGTGCTTCCCATGGGG - Intronic
956445363 3:69320902-69320924 TGGCCTGTTTGCTCCCCAGCTGG + Intronic
959042005 3:101432371-101432393 AGGCCTGTGTTCTTCCCTTCAGG - Intronic
959135493 3:102414021-102414043 CGAGCTGTGTGCTTTCCAGTTGG + Intronic
959414104 3:106062347-106062369 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
960802067 3:121549801-121549823 TGGGCTCTGTTGTTCCCAGCAGG - Intergenic
961558591 3:127713449-127713471 AAGGCTGTGTGGGCCCCAGCAGG - Intronic
962344308 3:134608299-134608321 AGGGCTGGGCACTTCCTAGCTGG - Intronic
962423627 3:135249796-135249818 ATGGCTGTGTTCTTTCCATCTGG - Intronic
962600634 3:136988353-136988375 AGGGCTGTGGGCCTCTCTGCTGG + Intronic
962688454 3:137869361-137869383 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
963515391 3:146301766-146301788 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
964209216 3:154209814-154209836 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
966728032 3:183125817-183125839 AGGGGTGTGTGCTACCATGCTGG + Intronic
968454362 4:689423-689445 CAGCCTGTGTGCTTCTCAGCAGG + Exonic
968541051 4:1168617-1168639 AGCTCTGTGTGCTCCCCAGGTGG - Intronic
969492783 4:7509584-7509606 TGGGCTGTGCACTTCCCATCTGG - Intronic
969714677 4:8862796-8862818 AGGGCCGTTTGCTCCCCAGGCGG + Intronic
971267818 4:25110556-25110578 AGGGCAGTGTTATTCCCACCGGG + Intergenic
972377928 4:38490321-38490343 AGGGCTTGTTGCTTACCAGCTGG + Intergenic
972909621 4:43798015-43798037 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
974630257 4:64479708-64479730 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
976146513 4:82046382-82046404 ACTGCTGTCTGCTTCCAAGCTGG - Intergenic
977044484 4:92051636-92051658 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
982073829 4:151719294-151719316 AGCACTGTGTCCATCCCAGCAGG - Intronic
982290732 4:153779922-153779944 AGGGCTTTCTGCTTCACAGATGG - Intergenic
982867771 4:160539762-160539784 AGGGCTCTTTGCTTCATAGCTGG - Intergenic
983145341 4:164207628-164207650 AGGGCTGCCTGCCTCCCTGCTGG + Intronic
983165888 4:164477154-164477176 AGGCCTGTGTCCTTCCCAGATGG + Intergenic
983931862 4:173461152-173461174 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
984465423 4:180095024-180095046 AGGCCTGTGGGCTTCCCAGGAGG + Intergenic
985042029 4:185900319-185900341 AAGGCTGTGTGGTTCACTGCTGG - Intronic
985099615 4:186445508-186445530 TGTGCTATGTGCTTCCCTGCAGG - Intronic
985496320 5:208602-208624 AGTGCTGAGGCCTTCCCAGCCGG + Intronic
986788901 5:11141699-11141721 AGGGCTGTCTGCTGCCAACCTGG - Intronic
986958602 5:13187106-13187128 AGGGCTGTGAGCCTTACAGCCGG - Intergenic
989146891 5:38258368-38258390 CGGGCTGTCTGCTTCCGAGGTGG + Intergenic
991418016 5:66411460-66411482 AGGGCTGTGTTCTTCTCTGGAGG - Intergenic
992639124 5:78753208-78753230 AGGGGTAGGTGCCTCCCAGCAGG + Intronic
994176713 5:96719206-96719228 AGGGTTCTGAGCTCCCCAGCAGG - Intronic
994853898 5:105091550-105091572 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
995777897 5:115745482-115745504 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
996594569 5:125185799-125185821 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
998507838 5:142686313-142686335 AGAGCTGTGTGCATCCCTGCGGG - Intronic
998767560 5:145504867-145504889 AAGTCTGTGTGGTTCTCAGCTGG - Intronic
999261700 5:150242520-150242542 AGGAATGTGTGCCTCCCTGCTGG + Intronic
999285612 5:150392638-150392660 AGGGCTCTGCCCTTCCCGGCTGG + Intronic
999468419 5:151829172-151829194 ACTGCTGTCTGCTTCTCAGCTGG + Intronic
1000121706 5:158203965-158203987 TGGGCTGTGAGCTTCTCACCAGG + Intergenic
1000204094 5:159040838-159040860 AAAGCTATGTGCTTACCAGCAGG - Intronic
1000226146 5:159263567-159263589 AGGGCTTTCTGTTTCCCAGTGGG + Intronic
1001442839 5:171758654-171758676 AGGGCTGGGGGCTTGCCAGGTGG + Intergenic
1002199761 5:177521129-177521151 ACAGCTGTGTGGTTGCCAGCCGG + Intronic
1003883011 6:10495482-10495504 AGGGCTGTGTGCTTGGGGGCAGG - Intronic
1004158903 6:13196116-13196138 AGCTCTGTGTGTTTCCCAGCAGG + Intronic
1005037314 6:21569125-21569147 AGGCCTGTGTCCTTCCCTTCCGG + Intergenic
1007666299 6:43515286-43515308 AGAACTCTGTGCTTGCCAGCCGG - Intronic
1009301702 6:62031814-62031836 AGGTCTGTGTCCTTCCCTTCTGG - Intronic
1009995823 6:70894147-70894169 AGGCCTGTCTGCTCTCCAGCCGG + Exonic
1010299423 6:74243147-74243169 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1010328147 6:74588507-74588529 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1011527665 6:88282601-88282623 ATGGCTGTATTCTTCCCAGGAGG - Intergenic
1013538953 6:111088304-111088326 AGAGCTGTGTGTTTGCAAGCAGG + Intronic
1014751615 6:125263049-125263071 AGGCCTGGGTTTTTCCCAGCGGG - Exonic
1014928469 6:127303975-127303997 AGGCCTGTGTTCTTCCCTGCAGG - Intronic
1015319445 6:131856175-131856197 AAAGCTGTGTTCTTCCCAGCAGG + Intronic
1016562173 6:145408815-145408837 AGGGCTCTCTGCTTCCTAGATGG + Intergenic
1016833449 6:148454711-148454733 TGGGCTGTGTGCATCACAGGAGG + Intronic
1017121452 6:151028079-151028101 AGGGCTGTGTGCTTCCCAGCAGG - Intronic
1017129475 6:151095629-151095651 AGGCCTGTGTCCTGCCCTGCAGG - Intronic
1017716984 6:157219431-157219453 AGGGCTGTGGGCAACTCAGCAGG - Intergenic
1018724905 6:166604451-166604473 AGTGGTGCGTGCTTCCCCGCTGG + Intronic
1018950357 6:168374823-168374845 AGGGCGGGGTGCTTGACAGCAGG + Intergenic
1019279044 7:191201-191223 AGGGCTGGGTGCGGCCCACCTGG - Intergenic
1019314119 7:376751-376773 TGGGCTGTGTGCCCCCCAGCAGG + Intergenic
1019330887 7:460289-460311 AGGGCTGAATTATTCCCAGCTGG + Intergenic
1021130915 7:16912716-16912738 AGGACTGTGTCCTTCCCTCCAGG + Intergenic
1024241470 7:47439566-47439588 ATCGCTGTGTCCTTCCCTGCCGG - Exonic
1024247942 7:47484661-47484683 AGAGCTGTGTGCGCTCCAGCAGG - Intronic
1025029631 7:55546763-55546785 TGGGCTCTGTGCTTCAAAGCTGG - Intronic
1027465588 7:78511096-78511118 AGGACTGTTTGCTTCACTGCTGG + Intronic
1028181565 7:87730643-87730665 AGGTCTGTGTCCTTCCCTTCAGG - Intronic
1029470843 7:100753082-100753104 AGGGCTGTGAGCTTCTCTGTGGG - Exonic
1030598961 7:111571155-111571177 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1031260153 7:119507690-119507712 AGGTCTGTGTCCTTCCCTTCAGG - Intergenic
1033068580 7:138180346-138180368 AGGACTGTGTTCTTCCCTGGAGG - Intergenic
1033139176 7:138809541-138809563 AGGGCTTTCTGGATCCCAGCAGG - Intronic
1033833543 7:145282354-145282376 AGGGCTGTGTCCTTTCCTTCAGG + Intergenic
1034820601 7:154213071-154213093 AGGGCTGTGTCCTCCACAGGTGG + Intronic
1038919802 8:32069972-32069994 AGTCCTTTGTGGTTCCCAGCTGG + Intronic
1040397019 8:47009954-47009976 AAGGCTGTGTGATTCTCATCTGG + Intergenic
1042726793 8:71887980-71888002 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
1043323287 8:79017716-79017738 AGGTCTGTGTCCTTCCCTTCAGG + Intergenic
1043340198 8:79229161-79229183 AGGTCTGTGTCCTTCCCTTCAGG + Intergenic
1045264825 8:100609970-100609992 AAAGCTGAGTGATTCCCAGCAGG - Intronic
1045505222 8:102773486-102773508 TGGGCTGGGGGCTGCCCAGCAGG + Intergenic
1046268111 8:111858380-111858402 AGGCCTGTGTCCTTCCCATTAGG + Intergenic
1049022416 8:139966457-139966479 GGGCCTGTGTGCCTCCCTGCAGG - Intronic
1049724832 8:144140924-144140946 AGGGGTGGGTTCTGCCCAGCTGG - Intergenic
1051921843 9:22275501-22275523 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1052214556 9:25950776-25950798 AGGCCTGTGTCCTTCCCTACAGG + Intergenic
1052977381 9:34421273-34421295 AGGGGTGTGTGTGTGCCAGCTGG + Intronic
1056211167 9:84366952-84366974 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1059259941 9:112966039-112966061 AAGGTTCTGTGCTTTCCAGCAGG + Intergenic
1060151008 9:121288252-121288274 AGAGCTGTGTTCATTCCAGCTGG + Intronic
1060188048 9:121575804-121575826 AGAGCTGTGGTCCTCCCAGCTGG + Intronic
1061309193 9:129751373-129751395 AGGCCTGGGTTCTTACCAGCAGG - Intronic
1061404121 9:130384306-130384328 TGGGCTCTGTGCTCCCCTGCTGG + Intronic
1061513076 9:131072609-131072631 TGGGCTGTGGGCTTCCCATAGGG + Exonic
1185680780 X:1886919-1886941 AGGGCTCTGTCCTTCTCAGATGG + Intergenic
1185710349 X:2298533-2298555 TGGGCTGTGTGCTTCAGACCAGG - Intronic
1185945596 X:4372371-4372393 AGGGATCTCTGCTTCCCAACGGG - Intergenic
1185945723 X:4373901-4373923 AGGGATCTCTGCTTCCCAACGGG - Intergenic
1187996246 X:24930101-24930123 AGTGCTATGTGCTTCCTAACTGG - Intronic
1188846224 X:35076068-35076090 AGGCCTGTGTTCTTCCCTTCAGG + Intergenic
1190708511 X:53049235-53049257 AAGGCTGTGTGCTGCCCACCTGG + Exonic
1191052661 X:56211593-56211615 AGGCCTGTGTCCTTTCCTGCAGG + Intergenic
1191829654 X:65402397-65402419 AGGCCTGTGTCCTTCCCTTCAGG - Intronic
1191846463 X:65551054-65551076 AGGGCAGTGTGGTGTCCAGCCGG - Intergenic
1192065521 X:67880625-67880647 AGGTTTGTGTGCTTCCCTCCAGG - Intergenic
1192393486 X:70754532-70754554 AGGCCTGTGTTCTTCCCTTCAGG - Intronic
1193409097 X:81141243-81141265 AGACCTGTGTCCTTCCCTGCAGG - Intronic
1193664674 X:84300664-84300686 AGGACTGTGTCCTTCCCTTCAGG - Intergenic
1194481032 X:94424623-94424645 AGGCCTGTGTCCTTCCCTTCGGG + Intergenic
1194568512 X:95523025-95523047 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1194917707 X:99724475-99724497 AGGGGTGTCTGCCTCCCTGCGGG - Intergenic
1195001244 X:100645332-100645354 AGAGTTTTGTGGTTCCCAGCGGG - Intronic
1195132196 X:101864038-101864060 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
1195971426 X:110477850-110477872 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1196065666 X:111461473-111461495 AGGGCTGTGTATTTCTCATCAGG - Intergenic
1196357209 X:114809060-114809082 AGGCCTGTGTCCTTCCCTTCAGG + Intronic
1196590903 X:117484450-117484472 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
1196713901 X:118792954-118792976 AGGGGTCTGTGCTTCACACCCGG - Exonic
1196865444 X:120066549-120066571 AGGCCTGTGTCCTTCCCTCCAGG - Intergenic
1196877650 X:120169731-120169753 AGGCCTGTGTCCTTCCCTCCAGG + Intergenic
1197139203 X:123097263-123097285 AGGACTGTGTCCTTCCCTTCAGG - Intergenic
1197470077 X:126856198-126856220 AGGCCTGTGTTCTTCCCTTCAGG - Intergenic
1198005711 X:132490281-132490303 AAGGCAGTGTGGTTCACAGCGGG + Intergenic
1199058851 X:143329306-143329328 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1199156215 X:144551609-144551631 AGGCCTGTGTCCTTCCCTTCAGG - Intergenic
1199334255 X:146600147-146600169 AGGCCTGTGTTCTTCCCTTCAGG + Intergenic
1199374160 X:147087950-147087972 AGGCCTGTGTCCTTCCCTTCAGG + Intergenic
1199679040 X:150212925-150212947 AGTGCTGTGTGTTTTCCTGCAGG + Intergenic
1201383565 Y:13413436-13413458 GGGGTTGTGTGCCTCCCAGTTGG - Intronic
1202595512 Y:26535119-26535141 AGGTCTGTGTCCTTCCCTTCAGG - Intergenic