ID: 1017121460

View in Genome Browser
Species Human (GRCh38)
Location 6:151028100-151028122
Sequence CTGGGTTGAGGCAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017121452_1017121460 -2 Left 1017121452 6:151028079-151028101 CCTGCTGGGAAGCACACAGCCCT 0: 1
1: 0
2: 2
3: 35
4: 362
Right 1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017121460 Original CRISPR CTGGGTTGAGGCAGGGAAGC AGG Intronic
No off target data available for this crispr