ID: 1017123085

View in Genome Browser
Species Human (GRCh38)
Location 6:151042135-151042157
Sequence GGTCTTAGATGACCACGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 6, 3: 2, 4: 48}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017123085_1017123088 28 Left 1017123085 6:151042135-151042157 CCAGCTCGTGGTCATCTAAGACC 0: 1
1: 0
2: 6
3: 2
4: 48
Right 1017123088 6:151042186-151042208 GTGTTTTCCATATTCCTTGATGG 0: 8
1: 0
2: 3
3: 18
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017123085 Original CRISPR GGTCTTAGATGACCACGAGC TGG (reversed) Intronic
901957700 1:12798239-12798261 GGTCATAGGTGGCCATGAGCAGG - Intergenic
901965694 1:12863992-12864014 GGTCATAGGTGGCCATGAGCAGG - Intronic
901981093 1:13034370-13034392 GGTCATAGGTGGCCATGAGCAGG - Intronic
902000994 1:13194560-13194582 GGTCATAGGTGGCCATGAGCAGG + Intergenic
902020224 1:13340264-13340286 GGTCATAGGTGGCCATGAGCAGG + Intergenic
906702833 1:47872306-47872328 GGTTTCAGATGACCTTGAGCAGG + Intronic
915501433 1:156321460-156321482 GGTCAAAGATGACCACCAACTGG + Intronic
923721794 1:236473315-236473337 TGTCTTAGATCTCCACGGGCCGG - Intronic
1078100476 11:8327670-8327692 GGCCATAGCTGACCACCAGCTGG + Intergenic
1083434026 11:62630487-62630509 GGTCTACGATGGCCACCAGCTGG + Exonic
1092588546 12:9925989-9926011 ATTCTTAGATGACCACCAGATGG - Intronic
1093405079 12:18795132-18795154 GGACTTAAATGACTACGACCTGG + Intergenic
1094084359 12:26573544-26573566 GGTCTAAGATGATAAGGAGCAGG + Intronic
1103565838 12:121814807-121814829 GTTCTTTGAGGACCACCAGCAGG - Exonic
1112694107 13:101928105-101928127 AGTTCTGGATGACCACGAGCTGG + Intronic
1119177391 14:72579232-72579254 GGTCTTCCATGACCACCACCTGG + Intergenic
1124059612 15:26277760-26277782 GTGCTTAGATGACCAAGAACTGG - Intergenic
1134834049 16:17346600-17346622 GGTCAGAGATGGCCACGAGGAGG + Intronic
1139361108 16:66400835-66400857 TGTCTGAGATGACCACGGGTAGG - Exonic
1139583810 16:67888365-67888387 GGTCTTGGATGGCTAGGAGCAGG + Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1142189254 16:88710145-88710167 TGTCCTAGATGTCCACGAGGTGG + Intronic
1145196966 17:20902271-20902293 GGGCGTAGAAGGCCACGAGCAGG - Intergenic
1156527107 18:37777852-37777874 GGACTCAGATGACCAAGAGGGGG + Intergenic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1160546381 18:79659254-79659276 GCTCTTGGGTGACCATGAGCAGG + Intergenic
1160832404 19:1109968-1109990 GGTCCTAGGTAACCCCGAGCAGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1163296630 19:16417007-16417029 GGTCTCAGATGGCGAGGAGCGGG - Intronic
1163837617 19:19584601-19584623 GGTCTGACATGACCAAGGGCTGG + Intronic
934545219 2:95208556-95208578 CTTCTTAGATGACAACTAGCTGG + Intronic
943071836 2:183150409-183150431 GGTCTTAGATGAACGCAAGAAGG - Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946333718 2:219024197-219024219 AGTCTTTGTTGACCAGGAGCAGG + Exonic
1171354685 20:24534696-24534718 GGACCTAGGTGACCACCAGCAGG - Intronic
1174210644 20:48875450-48875472 GGTGTGACATGACCACAAGCTGG + Intergenic
1180358990 22:11868860-11868882 GGTCTCAAATGACCAGGAGTAGG - Intergenic
973828639 4:54735907-54735929 GGTCCAAGATGACCACCAGGTGG + Intronic
983606085 4:169585888-169585910 GGTCTTAAATGAAGACCAGCAGG - Intronic
985633647 5:1025820-1025842 GGGCTGAGATGCCCACTAGCGGG - Intronic
996032665 5:118723198-118723220 TGTCATAAATGACCACAAGCTGG + Intergenic
1017123085 6:151042135-151042157 GGTCTTAGATGACCACGAGCTGG - Intronic
1019894545 7:3973407-3973429 GTCTTTAGATGACCACGGGCAGG - Intronic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1036208606 8:6824040-6824062 GGACTTAGAGGATCAGGAGCTGG - Intronic
1037101806 8:15055896-15055918 GGTTTTAGATGAAAAAGAGCAGG - Intronic
1047288204 8:123506439-123506461 GGTCTTCGCTGAGCACGTGCAGG + Exonic
1051528482 9:18074151-18074173 GGTCTGAGATGCCCACCAGCTGG + Intergenic
1053684447 9:40508262-40508284 GGTCTTAGACGTCCACGAGCTGG - Intergenic
1053934416 9:43136548-43136570 GGTCTTAGACGTCCACGAGCTGG - Intergenic
1054279278 9:63116690-63116712 GGTCTTAGACGTCCACGAGCTGG + Intergenic
1054297542 9:63343729-63343751 GGTCTTAGACATCCACGAGCTGG - Intergenic
1054395558 9:64648235-64648257 GGTCTTAGACGTCCACGAGCTGG - Intergenic
1054430205 9:65153435-65153457 GGTCTTAGACGTCCACGAGCTGG - Intergenic
1054500178 9:65868097-65868119 GGTCTTAGACGTCCACGAGCTGG + Intergenic
1060996355 9:127876669-127876691 GGGCTTAGATTACCAGGAGGGGG - Intronic
1192901540 X:75503746-75503768 GGTAATAAATGACCACAAGCTGG + Intronic