ID: 1017124247

View in Genome Browser
Species Human (GRCh38)
Location 6:151051006-151051028
Sequence CCTCCAGGAAGGGTGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 1, 1: 0, 2: 7, 3: 92, 4: 600}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017124247_1017124263 27 Left 1017124247 6:151051006-151051028 CCGCCCTCCACCCTTCCTGGAGG 0: 1
1: 0
2: 7
3: 92
4: 600
Right 1017124263 6:151051056-151051078 CCTCCAATCTTCTACTTACTTGG No data
1017124247_1017124258 -10 Left 1017124247 6:151051006-151051028 CCGCCCTCCACCCTTCCTGGAGG 0: 1
1: 0
2: 7
3: 92
4: 600
Right 1017124258 6:151051019-151051041 TTCCTGGAGGTTGATGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017124247 Original CRISPR CCTCCAGGAAGGGTGGAGGG CGG (reversed) Intronic