ID: 1017124474

View in Genome Browser
Species Human (GRCh38)
Location 6:151052460-151052482
Sequence CAAGGGATACAGAAGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 575}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017124474 Original CRISPR CAAGGGATACAGAAGAAGGA TGG Intronic
900285100 1:1895274-1895296 CAAAGGACAGAGAATAAGGAGGG + Intergenic
900324453 1:2101397-2101419 CAAGGGAAAGAAAGGAAGGAGGG - Intronic
900370911 1:2331767-2331789 CAGTGGTTACATAAGAAGGACGG - Intronic
900825969 1:4927236-4927258 CAAAGGAGACACAAAAAGGAAGG + Intergenic
902362798 1:15951290-15951312 GAAAGGAGAGAGAAGAAGGAAGG + Intronic
902575939 1:17377621-17377643 CAAGGTTTACACTAGAAGGATGG - Intronic
902826229 1:18976226-18976248 GAAGTGAGACAGAAAAAGGAAGG + Intergenic
903234723 1:21942366-21942388 CAAGGGACACCAAAGCAGGAAGG + Intergenic
903530378 1:24025748-24025770 AGAGGCAAACAGAAGAAGGATGG - Intergenic
904247429 1:29197740-29197762 GCAGGGATACAGAAGAGAGAGGG - Intronic
904377591 1:30091501-30091523 GAAGGGATGCAGAGGATGGAGGG + Intergenic
904604816 1:31692520-31692542 GAAGGGAGACAGAGGAAGGGAGG + Intronic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905279263 1:36838556-36838578 CAAGGGTTACAGAGGAAGATGGG - Intronic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
905898084 1:41561994-41562016 CAAGGAAGAAAGAAGAGGGAAGG + Intronic
906610623 1:47199388-47199410 GAAGGGATCCAGGAGAAGGATGG + Intergenic
906816490 1:48885627-48885649 CAAGAGAAACAGCAGAAGAAAGG - Intronic
907082412 1:51636130-51636152 CAAGAGAGAGAGAGGAAGGAAGG - Intronic
907463424 1:54619806-54619828 CAAGGGATAGAGAAGACAGAGGG - Intronic
907517525 1:55002021-55002043 AAAGACATCCAGAAGAAGGAAGG + Intronic
908037620 1:60073439-60073461 CAAGGGTCACAGAGGAATGAAGG + Intronic
908800893 1:67879630-67879652 AAAGGGAGAGAGAGGAAGGAAGG - Intergenic
909050334 1:70759119-70759141 CAAGGCAGGAAGAAGAAGGAAGG - Intergenic
909296364 1:73954286-73954308 GACGGGAGACAGAGGAAGGAAGG - Intergenic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910184378 1:84521146-84521168 AGAGGGAGAGAGAAGAAGGAAGG + Intergenic
910220051 1:84880822-84880844 CAGAGGGTACAGAAGAAGGAAGG + Intronic
910523275 1:88148434-88148456 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
910559780 1:88577943-88577965 AAAGTGATACAGTAGAAGAAGGG + Intergenic
910594579 1:88965771-88965793 CAAGGGATAGAAAATCAGGATGG - Intronic
911493204 1:98595082-98595104 ACAGAGATACAGTAGAAGGATGG - Intergenic
912248569 1:107987668-107987690 CAAGGGAGAAAGATGAAGGCAGG + Intergenic
913053400 1:115136364-115136386 CAAGGGACAGATAAGAAGGGTGG + Intergenic
914704789 1:150161731-150161753 CAGGGGAGCCAGAAGATGGAGGG + Intronic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
915017016 1:152743807-152743829 AAAGAGAGACAGAAGAAGGCAGG + Intronic
915368757 1:155330555-155330577 CCAGGGCTACAGAACAAGGGAGG - Exonic
915965754 1:160306840-160306862 CAATGGAGGCAGCAGAAGGAGGG + Intronic
916011323 1:160708602-160708624 CAAGGGAGAGAAAAGAAGCAAGG + Intronic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
916577155 1:166078354-166078376 GAAGGGTTATAGGAGAAGGAAGG - Intronic
916668173 1:166986400-166986422 CATGGGAGACAGAAGTGGGACGG + Intronic
916745006 1:167678474-167678496 CAAGGGAAAGAGAAGAATCATGG - Intronic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918746024 1:188200852-188200874 TAAGGAACACAGAAGTAGGAAGG - Intergenic
918796451 1:188904013-188904035 CAAGGGAAAGAAAAGAAGGAAGG + Intergenic
919903185 1:202058894-202058916 TGAGGGATACAGAAGAATCAAGG - Intergenic
920435768 1:205946062-205946084 CTAGGGAAACAGAAGACAGAAGG + Intergenic
921184145 1:212655787-212655809 GAAGGGATACAGGATGAGGAAGG - Intergenic
921380396 1:214518670-214518692 CAAGTGGGACAGAACAAGGAAGG + Intronic
921483368 1:215689036-215689058 CAAGGGAAAGAGAGGAATGAAGG + Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
923010134 1:230082147-230082169 CACGGACTAGAGAAGAAGGATGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923825414 1:237494374-237494396 CACGGGAGAAAGATGAAGGATGG + Intronic
924445622 1:244127784-244127806 CTGGGGATACAGAGGAAGGTGGG - Intergenic
924846797 1:247782530-247782552 CAAGGGAGACAGATGTAGGCTGG + Intergenic
924869208 1:248022555-248022577 GAAGGGAAACACAAGAAAGATGG - Exonic
924919203 1:248609216-248609238 CAAGGTTTACAGAAAAATGATGG - Intergenic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
1063071358 10:2669704-2669726 CAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1063517377 10:6710340-6710362 TGAGGGAGAGAGAAGAAGGAAGG + Intergenic
1063548710 10:7007595-7007617 GTAGGGATAAAGAAGGAGGAAGG - Intergenic
1063605746 10:7521448-7521470 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1063717728 10:8545169-8545191 GAAATGATACAGAACAAGGAAGG - Intergenic
1064256169 10:13744290-13744312 CCAGGGCCACAGAACAAGGAGGG - Intronic
1064392974 10:14957486-14957508 CCGGGGCTACAGAGGAAGGAGGG + Intergenic
1064513383 10:16119772-16119794 TAAGGAAAACTGAAGAAGGAAGG - Intergenic
1065612432 10:27485263-27485285 AAAGGGTTACAGAAGAAAGATGG - Intergenic
1066476421 10:35751401-35751423 CAGGAGATACAGCAGAATGAGGG - Intergenic
1067907065 10:50303509-50303531 AAAGGAAGACAGAAAAAGGAAGG + Intergenic
1068157276 10:53216963-53216985 AAAGGGACAAAGAGGAAGGAAGG - Intergenic
1068563397 10:58543348-58543370 CAAGGGATAGGGATGAAGAAAGG + Intronic
1068751606 10:60599844-60599866 AAAGGGTTACAGAGGAAGGCAGG - Intronic
1068917739 10:62451100-62451122 CAATGGCTACAGAATGAGGAAGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1070558939 10:77551278-77551300 CTAGGGAGAGAGAAGAATGAAGG - Intronic
1072379306 10:94850954-94850976 CAAAGGTCACAGAAAAAGGAAGG - Intronic
1072439280 10:95439409-95439431 CAAGGGCCAGAGAAGGAGGAAGG - Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1074454949 10:113588551-113588573 CAAGGGAGGCAGAAGAAGCCTGG - Exonic
1074916438 10:117960374-117960396 GAAGGGATATATATGAAGGAGGG - Intergenic
1075344495 10:121672193-121672215 AAATGGATAGAGAAGAAGGAAGG - Intergenic
1075680808 10:124329952-124329974 CAGGGGATGGAGAAGAAGAATGG - Intergenic
1076252414 10:128994952-128994974 AAAGGGAGAGAGAGGAAGGAAGG + Intergenic
1076426061 10:130368433-130368455 ACAGGGATTCAGAAGAAGGAGGG + Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077802544 11:5555430-5555452 GAAGGGAGAGAGAAGAAGGAAGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079433681 11:20422860-20422882 CAGGGGACTCAGAAGAAGTAGGG + Intronic
1079481485 11:20885241-20885263 AAAGGGAGACAAAAGCAGGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079961674 11:26931930-26931952 TATGGGACATAGAAGAAGGAGGG + Intergenic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080038555 11:27734899-27734921 AAAGAGCTACAGATGAAGGAAGG - Intergenic
1081462105 11:43281426-43281448 CAAGGGATAGAGCAGGAGGCAGG - Intergenic
1081785686 11:45745249-45745271 CAAGGGAGACAGGAGAGGGTGGG + Intergenic
1082025894 11:47571839-47571861 CATGGGATACAGGACAGGGATGG + Intronic
1082052677 11:47785045-47785067 CAAGTGCTACAGATGAAGCATGG - Exonic
1082588897 11:54980300-54980322 CAAGGGAAAAACTAGAAGGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083311930 11:61788183-61788205 CAAAGGAGAGAGAAGAAGGGAGG - Exonic
1083370327 11:62173816-62173838 AAAGAGAGAGAGAAGAAGGAAGG - Intergenic
1084919585 11:72458284-72458306 GAAGGGAAAGAAAAGAAGGAAGG + Intergenic
1085294453 11:75423240-75423262 CAGGGGATGGAGAAGAAGGTAGG + Intronic
1085414254 11:76309891-76309913 CATTGGCTACAGAACAAGGAAGG - Intergenic
1085690372 11:78659428-78659450 CAAGGGCTGCTGGAGAAGGAAGG + Intronic
1085827087 11:79859144-79859166 AAAGGCATACAGAGGAAGCAAGG + Intergenic
1086141236 11:83502836-83502858 CAATGGAAACAGAAAAAGAATGG - Intronic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1086960982 11:92979988-92980010 CACGGGGTACAGAAAAAGGGAGG - Intronic
1087291578 11:96326461-96326483 AAAGGGATATAAAAGAAAGAAGG - Intronic
1087980030 11:104600620-104600642 CCAGGGATTAGGAAGAAGGAAGG + Intergenic
1088080427 11:105905363-105905385 AAAGGTGTACAGAAGAAAGATGG + Intronic
1088405511 11:109471931-109471953 CAATAGATACATAAGAAGAAAGG + Intergenic
1088943376 11:114483797-114483819 TCAGGGAAAGAGAAGAAGGAAGG - Intergenic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1089577147 11:119453135-119453157 CAAGGGATGAAGAATAAAGAGGG + Intergenic
1090147381 11:124339988-124340010 AAAGGGATACGGGAGAAGGGTGG + Intergenic
1091147974 11:133297208-133297230 AAAGGGATAGAGAATAAGGTGGG + Intronic
1093524353 12:20090455-20090477 TAAGGGATACACAGGAAGGTGGG + Intergenic
1093626616 12:21356490-21356512 AAAGGGAGAGAGAAAAAGGAAGG + Intronic
1095166860 12:38983234-38983256 CTAGGGTAACAGAAGTAGGAAGG - Intergenic
1095262604 12:40114058-40114080 CACGGGAGACAAAAGATGGATGG + Intergenic
1095693260 12:45115048-45115070 GGAGAGAGACAGAAGAAGGATGG + Intergenic
1096312996 12:50537990-50538012 AAAGGAATAAAGAACAAGGATGG + Intronic
1096446251 12:51695078-51695100 CAAAGGAAAAAGAAGAAGAAAGG - Intronic
1097554895 12:61124188-61124210 CAAGGGACAAAGATGAAGGCTGG - Intergenic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1099696472 12:86028103-86028125 AAAGGGATCCAGAAGATGCAAGG - Intronic
1100742873 12:97614679-97614701 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1100811321 12:98341307-98341329 AAAGGGATAAGGAGGAAGGAAGG + Intergenic
1101225339 12:102682577-102682599 CAAGGGATAGAGCAGAAGTGGGG + Intergenic
1101295592 12:103420442-103420464 AAAGGGATACAGAAGACAAAAGG - Intronic
1101681228 12:106967775-106967797 GGATGGATACAGAGGAAGGATGG + Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1101912490 12:108870689-108870711 CAAGGGAGAGAGATGAAGCAGGG + Intronic
1102397188 12:112596666-112596688 CAAGCAATATAGAAGAAGGGTGG - Intronic
1102549405 12:113680462-113680484 CCAGGGATACAGGAGAAGAGAGG - Intergenic
1102673241 12:114637757-114637779 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1104386300 12:128354507-128354529 AAAGAGAGAGAGAAGAAGGAGGG - Intronic
1104435995 12:128757082-128757104 GAAGGGAGAAAGAAGAAAGAAGG + Intergenic
1104639794 12:130460079-130460101 CAAGGGAGACAGAAAACGGGTGG + Intronic
1106887948 13:34210446-34210468 CACATGGTACAGAAGAAGGAAGG - Intergenic
1107143937 13:37036674-37036696 AAAGAGATAAAGAAGATGGAAGG - Intronic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107272581 13:38637810-38637832 CAAAGTATACAGAAGAAGCATGG + Intergenic
1108039463 13:46325762-46325784 CAAGAAACACAGTAGAAGGAAGG + Intergenic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108818956 13:54322080-54322102 CAAAGGAGGCAGAAGAAGGTGGG + Intergenic
1109176554 13:59164989-59165011 AAAGGGATAAAGTAGAAGCAAGG - Intergenic
1109278678 13:60330708-60330730 CAAGTGATACAGAAGAATACAGG - Intergenic
1109447028 13:62454378-62454400 TAAGGGAGACTGAAAAAGGAAGG + Intergenic
1109718905 13:66252317-66252339 GAAGGGAAAGAGAAGAAGCAGGG + Intergenic
1109826050 13:67723564-67723586 GAAAGGATAGAAAAGAAGGAAGG - Intergenic
1110160204 13:72367795-72367817 TAAGAGAGACAGAAGATGGATGG - Intergenic
1110410045 13:75194925-75194947 CAAGGGCAACAGAGGAAGGTTGG - Intergenic
1110503184 13:76253212-76253234 AAAGGGCTAAATAAGAAGGAAGG + Intergenic
1110526393 13:76543297-76543319 CAAGGGATAGAGTGGAGGGAGGG - Intergenic
1110651105 13:77942121-77942143 CAAGGGAGACAGCAGAGGGAAGG - Intergenic
1111788396 13:92820598-92820620 CAAGGGAGAGGGAAGCAGGAGGG - Intronic
1113697218 13:112354922-112354944 GAAGGGAGACAGAAGGGGGAGGG + Intergenic
1114169029 14:20253205-20253227 CAAGGGATAAGAAAGAAGGGAGG + Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114379883 14:22191274-22191296 CATGGGAGAAAGATGAAGGATGG + Intergenic
1115084171 14:29493284-29493306 AAAGGGAAACAGAAGAGGAAGGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117831989 14:59760970-59760992 CAAGGGACTCAGAACTAGGAGGG - Intronic
1118459543 14:65976004-65976026 GAAGGGAAGCAGGAGAAGGAGGG + Intronic
1118480606 14:66161460-66161482 CTAGGCATCCAGAAAAAGGAAGG - Intergenic
1118674058 14:68163618-68163640 CTTGGGAAACAGAAGAAGGCAGG - Intronic
1118919130 14:70133777-70133799 CCAGGAATACAGAAGAAGATGGG + Intronic
1119012604 14:71010966-71010988 CAATGGAAACAGTAGGAGGAGGG + Intronic
1119297251 14:73543015-73543037 CAAAGGAAAAAGAAGAAGAATGG - Intronic
1119611347 14:76065493-76065515 CAAGGGAGAGAGAGGAAGGATGG - Intronic
1120210357 14:81628240-81628262 CCATGGAGACAGAAGAAGGGTGG - Intergenic
1121152934 14:91654070-91654092 AAAGGGATAAAGAAGGAGGTGGG + Intronic
1121657366 14:95607094-95607116 CAAGCCACACATAAGAAGGAAGG - Intergenic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1121927265 14:97939293-97939315 AAAGGGAGACAGAATAAGCAGGG - Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124109107 15:26771594-26771616 CCAGGGAATCAGGAGAAGGATGG - Intronic
1125815912 15:42584051-42584073 CCAGGCAAACAGAAGACGGAGGG + Intronic
1125930652 15:43597579-43597601 CAAGGGATCTAGCAGAATGATGG - Intronic
1126741451 15:51780542-51780564 AAAGGGATAAAAAAGAAGAATGG - Intronic
1127205742 15:56716389-56716411 CTAGGCAAACAGGAGAAGGAAGG + Intronic
1127245481 15:57168706-57168728 GAAGAGATTCAGAAGAATGATGG - Intronic
1128137644 15:65275814-65275836 CAAGGAATAGAAAAGAAGGAAGG - Intronic
1128523740 15:68393120-68393142 CAATGGATACAGCAGAAAGCTGG + Intronic
1128670321 15:69569932-69569954 CAAGGGATTGAGAAACAGGAAGG - Intergenic
1129140333 15:73592173-73592195 CCAGGGCTACAGAGGATGGAAGG - Intronic
1129329153 15:74818027-74818049 AAAGAGAGAGAGAAGAAGGAGGG + Intronic
1129829159 15:78656741-78656763 TAAGGGAATCAGAAGAAGGGAGG - Intronic
1130894380 15:88158969-88158991 CAAGGGATAGAGAGGGAGAAGGG + Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131116715 15:89800422-89800444 CCAAGGCTACAGATGAAGGAAGG - Intronic
1131392323 15:92059437-92059459 CAAGGGTGACGGAAGAAGCATGG - Intronic
1132358446 15:101191406-101191428 CAGGGGTTACAGGGGAAGGAAGG + Intronic
1132406290 15:101543381-101543403 CAAGGGAAGCGGAAGGAGGAAGG - Intergenic
1132694061 16:1194380-1194402 CCAGGGAACCAGAGGAAGGAGGG - Intronic
1133589558 16:7229580-7229602 AAAGGGAGAGAGAGGAAGGAAGG + Intronic
1133589606 16:7229765-7229787 GAAGGGAGAGAGAGGAAGGAAGG + Intronic
1133589615 16:7229801-7229823 GAAGGGAGAGAGAGGAAGGAAGG + Intronic
1133589629 16:7229855-7229877 GAAGGGAGAGAGAGGAAGGAAGG + Intronic
1135412567 16:22246223-22246245 CAAAGGGTACAGAAGAAGACTGG + Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135739057 16:24957707-24957729 CAAAGGATTCAGGAGTAGGAAGG + Intronic
1135939592 16:26809746-26809768 CAAGGGAGAAGGAGGAAGGAAGG + Intergenic
1136539116 16:30918804-30918826 GAAGGAAGAAAGAAGAAGGAAGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137956667 16:52838369-52838391 CAAGGGTTAGAGGAGAAGAAAGG - Intergenic
1138087153 16:54143577-54143599 AAAGAAATAAAGAAGAAGGAAGG + Intergenic
1138210292 16:55157570-55157592 GAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1138990614 16:62386756-62386778 CATGTGATACAGGAGAAGCATGG + Intergenic
1140724425 16:77799259-77799281 AGAGGGAGAGAGAAGAAGGAGGG - Intronic
1140725962 16:77812435-77812457 TATGGGATACACAATAAGGAAGG + Intronic
1140736140 16:77899442-77899464 CAAGGGTTACAGATGCAGAAAGG - Intronic
1140742735 16:77955857-77955879 CAATGGAGAGCGAAGAAGGAAGG - Intronic
1140792982 16:78410105-78410127 CAAGAGCAACAGAGGAAGGAAGG - Intronic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141263318 16:82473466-82473488 CAAGCAATAGAGAAGAAGGAAGG - Intergenic
1142781009 17:2181223-2181245 TATGGGAAACAAAAGAAGGAAGG + Intronic
1142901562 17:3015346-3015368 CAAGGGATGCAGACTCAGGAGGG - Intronic
1143443525 17:6994159-6994181 AAAGGGAAACAAAAGCAGGAGGG + Intronic
1143897562 17:10148264-10148286 CAAGGGATGCAGGTGAAGAAAGG - Intronic
1144560968 17:16320141-16320163 GAAGGGAGAGAGAGGAAGGAAGG + Intronic
1146271935 17:31490285-31490307 CTACGGGTACAGATGAAGGAGGG - Intronic
1146487821 17:33258403-33258425 TAAGGGACAGAGAAGGAGGATGG + Intronic
1147158843 17:38559255-38559277 CGAGGGATACTGACGACGGAGGG + Intronic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1148702882 17:49601051-49601073 CAAGTGAGGCAGAAGAGGGAGGG - Intronic
1149106558 17:52974531-52974553 CATGGGATAAAGATGAAGGCTGG + Intergenic
1149749314 17:59129866-59129888 AAAGGGAGGGAGAAGAAGGATGG + Intronic
1149783292 17:59415207-59415229 CAAGGGAAACAGCAGAAGAGAGG + Intergenic
1150225980 17:63524613-63524635 CCAGGGACACAGCAGAGGGATGG - Intronic
1150827095 17:68486584-68486606 GAAGGAAAGCAGAAGAAGGAAGG - Intergenic
1151505285 17:74523242-74523264 CAAGGGACACAGAACAGGAAGGG - Intronic
1151683549 17:75634211-75634233 CAATGGCCACAGAAGAAGGGGGG + Intronic
1151757683 17:76083912-76083934 CAAGGGAAAAAGGAGAAGGGTGG - Intronic
1151778852 17:76228496-76228518 CAAGTGTTAAACAAGAAGGATGG - Intronic
1151870315 17:76832343-76832365 CACGGGAGAAAGAAGAAGGCCGG + Intergenic
1152732718 17:81980514-81980536 CAAGAGAGACTGGAGAAGGATGG - Intronic
1153267339 18:3284201-3284223 CAAGTGAAACAGAAGACAGATGG + Intergenic
1155522701 18:26685184-26685206 CAAGGGAGAGAGAAGAATGGTGG + Intergenic
1155692588 18:28644084-28644106 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1156025442 18:32648603-32648625 CCATGGAGACAGTAGAAGGATGG - Intergenic
1156169863 18:34469672-34469694 CAAGGGAGAAAGATGAAGGCTGG - Intergenic
1156212124 18:34956013-34956035 TAAGGGATACATATGAAGGTTGG - Intergenic
1156416100 18:36892381-36892403 GAAGGGATATGGAAGAAGAAAGG + Intronic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1158127739 18:54120716-54120738 CAAAGGAAACAGAAGAAGGCTGG + Intergenic
1158391892 18:57051188-57051210 CAGGGGATAGAGAGGAGGGAGGG - Intergenic
1159097906 18:63925705-63925727 TAATGAATACAGAAGAATGATGG + Intronic
1159175721 18:64831234-64831256 CAAGAGAGAGAGAATAAGGAGGG + Intergenic
1159350676 18:67268885-67268907 CAAGGAATAGAGGAGAAGGTGGG - Intergenic
1159810278 18:73010907-73010929 GAAGGGATTCAGAGGAAGGGTGG + Intergenic
1160092778 18:75842606-75842628 CACGGGAGAAAGAAGAAGGCCGG - Intergenic
1160174966 18:76585915-76585937 GAAGGGAGAAAGAAGAAAGAAGG - Intergenic
1160309756 18:77778425-77778447 CAAGGGACAAAGAAGAAGAGGGG + Intergenic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1162740602 19:12771504-12771526 TCAGGGATTCAGGAGAAGGACGG + Intronic
1162877808 19:13633867-13633889 GAAAAGAGACAGAAGAAGGAAGG - Intergenic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163175232 19:15560070-15560092 CAAGAGATGCAGGAGAAGCAGGG - Intergenic
1164173010 19:22742637-22742659 CAAGGTATTTAGAAGAAAGAGGG + Intergenic
1164260870 19:23567889-23567911 AGAGGGAGACAGAAGAAAGAGGG - Intronic
1164592609 19:29514496-29514518 CAGGGGATGAGGAAGAAGGAGGG + Intergenic
1165322639 19:35095762-35095784 AAAGGGAGAGAGAGGAAGGAAGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165962546 19:39547502-39547524 CAAGGGGAAGAGAAGAAGGATGG - Intergenic
1166076791 19:40418324-40418346 GAAGGGAGAGAGAGGAAGGAAGG - Intergenic
1166614956 19:44235420-44235442 CAAGGGATTCAGTAGCAGCACGG + Exonic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1167688601 19:50971421-50971443 CAAGGGATACAGAGAACAGAGGG - Intergenic
1168317818 19:55491674-55491696 CAAGGGGTACAGGAGAGGGGAGG - Intronic
925774094 2:7316245-7316267 CAGGGGTTACAGGAGAGGGAGGG + Intergenic
925911181 2:8574572-8574594 TCAGGGACACAGAAGAAGGAGGG + Intergenic
926707051 2:15844305-15844327 CCATGGAAACAGGAGAAGGAAGG - Intergenic
926833194 2:16987935-16987957 CAAGGGGTATAAAAGAAGGAAGG - Intergenic
927060681 2:19416448-19416470 AAAGAGAGAAAGAAGAAGGAAGG - Intergenic
927067828 2:19491762-19491784 GAAGAGAAACAGAAGAGGGAGGG + Intergenic
927659510 2:24981039-24981061 AAAGAGAGAGAGAAGAAGGAGGG + Intergenic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
929187657 2:39112143-39112165 CAAGTGATAGAGAGGAAGTAAGG - Intronic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930605916 2:53492965-53492987 CAGGGGATAAAGAAGAGGGGAGG + Intergenic
930696552 2:54417217-54417239 GAAAGGAAACAGAAGTAGGAGGG + Intergenic
931522313 2:63112274-63112296 CAGGGGTTACAGGAAAAGGAGGG - Intergenic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
932920273 2:75905937-75905959 CACGGGAGAAAGATGAAGGACGG - Intergenic
933446247 2:82383345-82383367 CAAGGGAGAAAGATGAAGGAAGG + Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934056211 2:88253391-88253413 GAAGGGAGAGAGAGGAAGGAAGG - Intergenic
934765040 2:96875931-96875953 ACAGGGAGACAGAGGAAGGAGGG + Exonic
934982281 2:98852931-98852953 AAAAGGAGAGAGAAGAAGGAAGG + Intronic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936616697 2:114055355-114055377 CAAGGGATGCAGATGGAGGGAGG - Intergenic
937284759 2:120743293-120743315 CAAAGGACAAAGAAGCAGGAAGG - Intronic
937627317 2:124057723-124057745 TAATGGATAAACAAGAAGGATGG + Intronic
937814670 2:126238012-126238034 CCAGGGAGTCAGAAGATGGAAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938297168 2:130185570-130185592 CAAGGGTTACAGCAGGAGGGGGG + Intronic
939015117 2:136893682-136893704 TAAGGTACACAGAAGAAGGTGGG - Intronic
939033883 2:137108436-137108458 AAAGGGGGACAAAAGAAGGAAGG - Intronic
939141787 2:138362624-138362646 AACGGTAGACAGAAGAAGGAGGG + Intergenic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939511056 2:143105267-143105289 CAAAGGATAAAGATCAAGGAAGG + Intronic
940071976 2:149698849-149698871 GAAGGGATACAGAAGCAGCCAGG + Intergenic
941322766 2:164075783-164075805 CAAAGGATAAAGGAGAAGAAAGG - Intergenic
941364817 2:164597621-164597643 CAATGGGTAGAGAAGAAGAAAGG + Intronic
942032585 2:171977761-171977783 AAAGGAATACAGAAGGAAGAAGG - Intronic
942318433 2:174715102-174715124 CTAGGGAGACAAAGGAAGGAGGG - Intergenic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
942581522 2:177424105-177424127 CAAGGGGAGCAGTAGAAGGAGGG - Intronic
943063597 2:183063856-183063878 AAAGGGAAACAAAAGAAAGAAGG - Intergenic
943881924 2:193156643-193156665 CAAGGGAGACAGAAAAGGTAAGG + Intergenic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
943979582 2:194531132-194531154 CATGGGAGACAGAACAAGCATGG + Intergenic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944863722 2:203840251-203840273 CAAGGGATAAGGATGAAAGAAGG + Intergenic
944952970 2:204774180-204774202 TAATAGATACAGAAGAAGAAAGG - Intronic
945050085 2:205815482-205815504 AATGGGAGACAAAAGAAGGAGGG + Intergenic
945862550 2:215140286-215140308 CCAGGAATTCAGGAGAAGGAAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946189601 2:218001479-218001501 CAGGGGTGACACAAGAAGGATGG - Intronic
946624191 2:221593411-221593433 CAAGGAATACTGAATAAGAAAGG + Intergenic
947502169 2:230679107-230679129 CAAAGAATAAAGAAGAAGGTAGG + Intergenic
947536473 2:230942961-230942983 CTAGGGGAACAGAAGCAGGATGG - Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947836141 2:233177003-233177025 CAAGGGATACTGAAGTAGTCAGG + Intronic
1169686253 20:8276363-8276385 CAAAGGATACAGCAGAAAAATGG - Intronic
1170075790 20:12417417-12417439 CTAGGGATAAACAAGAGGGAGGG - Intergenic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170199965 20:13731962-13731984 CAAAGGATACAGAGGAAATAGGG - Intronic
1170773193 20:19352014-19352036 CAGGGGATACCGATGAAGGAGGG + Intronic
1170933040 20:20786040-20786062 GAAGAGAGAGAGAAGAAGGAGGG - Intergenic
1171985615 20:31658906-31658928 CAAGGAAGAGAGAGGAAGGAAGG - Intergenic
1173283529 20:41650128-41650150 AAAGGGACACAGACAAAGGAAGG - Intergenic
1173328471 20:42054624-42054646 CAAGGGAGTTAGAAGAAGGTTGG + Intergenic
1173589043 20:44210292-44210314 CAAGGGATGCGGGAGAAGAAAGG + Intronic
1174122184 20:48274338-48274360 CAACGGGGACAGAAGAATGAGGG - Intergenic
1174266059 20:49333085-49333107 CAATGGATAGAGGAGAAGCAAGG + Intergenic
1175637304 20:60596548-60596570 CAAGGGCTTCAGAACAATGACGG - Intergenic
1176261374 20:64182642-64182664 CCAGGGATACAACAGGAGGATGG - Intronic
1176407545 21:6429656-6429678 CAGGGGTTACAGAAGAAGCGTGG + Intergenic
1178136519 21:29633801-29633823 CTAGGGATGCTGAAGAATGAGGG + Intronic
1178240104 21:30889480-30889502 CAATGGATACAGAAAATGGAAGG - Intergenic
1178361052 21:31948720-31948742 CCAGGGAAACAGAAGCTGGAAGG + Intronic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179255813 21:39714326-39714348 CAAGGGAAACAGTAGATGCAAGG - Intergenic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1179644742 21:42768590-42768612 CAAGGACTGCAGAAGCAGGAGGG + Intronic
1180789223 22:18565355-18565377 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1181232518 22:21429956-21429978 CAAGGTCTACAGGAGAAAGAAGG - Intronic
1181246133 22:21504901-21504923 CAAGGTCTACAGGAGAAAGAAGG + Intergenic
1182478467 22:30590242-30590264 CGAGGGATACAGAAGTGTGAGGG - Intronic
1183162529 22:36124431-36124453 CAAGGGATGATGAAGAAGGTTGG - Intergenic
1183759448 22:39802653-39802675 AAAGGGAAACAGGAGAAAGAAGG + Intronic
1183851177 22:40589515-40589537 CAAGGGATACATGAGAAGACTGG + Intronic
1183879718 22:40817316-40817338 CAAAGGAGACAAACGAAGGATGG - Intronic
1183991201 22:41598178-41598200 AAAGGGATAGGGAAGGAGGAGGG - Exonic
949596129 3:5549026-5549048 CAAGGGATACAGAGGAAACATGG + Intergenic
949832469 3:8230248-8230270 CAAGAGATACAGAGGAAAGGTGG - Intergenic
950401711 3:12774076-12774098 ACAGGGACACAGAAGAGGGAAGG - Intergenic
950402686 3:12782050-12782072 CAGGGGCTCCAAAAGAAGGAGGG + Intergenic
951563163 3:23988057-23988079 AAAGAGAGAGAGAAGAAGGAAGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
951936421 3:28027923-28027945 CAAGGGTGAAACAAGAAGGAAGG - Intergenic
952329977 3:32355867-32355889 CTAGCGAGACAGAAGCAGGAAGG - Intronic
952584962 3:34880642-34880664 CAAGAGTTACAGAAGAAAAAGGG - Intergenic
952766543 3:36959104-36959126 GAAGGAATACACATGAAGGAGGG - Intergenic
952998781 3:38911186-38911208 CAAGTGCTCCAGAAGAATGAGGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
955113309 3:55971814-55971836 TAAAGGGTACAGAAGAAGGAGGG - Intronic
955496665 3:59540654-59540676 GAAGGGAGAGAGAGGAAGGAGGG + Intergenic
956782014 3:72611195-72611217 CAAGGGAGACAGAAGCATCAGGG + Intergenic
957508064 3:81151463-81151485 CATGGGATGCAGAAATAGGATGG + Intergenic
957822193 3:85391477-85391499 TAAAGGATACACAAGATGGAAGG + Intronic
958780009 3:98529960-98529982 CCAGGGACACAGGAGAAGGCAGG + Intronic
959459723 3:106610490-106610512 CAAGGGATATAGCTAAAGGATGG + Intergenic
960365581 3:116767522-116767544 GAAGAGAGAAAGAAGAAGGAGGG + Intronic
961347750 3:126275037-126275059 AAAGGGAAAAAGAAGAATGAAGG - Intergenic
961452156 3:127007118-127007140 CGAGGGCTACAGGAGAAGCAGGG + Intronic
962731823 3:138290426-138290448 CAAGGGGTACAGGAGGAGTAGGG + Intronic
963524464 3:146399701-146399723 AAAGGGAGAGAGCAGAAGGAAGG - Intronic
963994008 3:151685420-151685442 CAAAGGATACAGATGAAGGCAGG - Intergenic
964523392 3:157591185-157591207 GAAGGGAGAGAGAGGAAGGAAGG - Intronic
965316711 3:167200568-167200590 AATGGGATAAAGAAGAAAGAAGG - Intergenic
965712366 3:171568282-171568304 CCAGAGACACAGAAGAAGCATGG + Intergenic
965910788 3:173772788-173772810 CAGTGAATACAGAAAAAGGATGG - Intronic
965988391 3:174785170-174785192 AGAGGGAAACAGTAGAAGGAGGG - Intronic
967450199 3:189614628-189614650 CAAGAGATACAAAATAATGAAGG - Intergenic
967691083 3:192474583-192474605 AAAGGTATAAAGAAAAAGGAAGG + Intronic
967913943 3:194564248-194564270 CTAGGGCTACAGAAGAAAGGGGG - Intergenic
968476429 4:811770-811792 CAAAGGACAGAGAAGCAGGAAGG - Intronic
969133631 4:5012019-5012041 CAAGAGATACAGAGGAAACAGGG + Intergenic
969985250 4:11202186-11202208 CAAGGGTTAAAGAGGCAGGAGGG - Intergenic
970449059 4:16149053-16149075 CAAAGGGTACAGAGGAAAGAGGG - Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
972041104 4:34600849-34600871 CAAGGAATACCGAAGATTGATGG - Intergenic
972191580 4:36598540-36598562 GAAAGGAAACAGAAGAAGGTAGG + Intergenic
973797445 4:54442568-54442590 CAAGGAGTTCTGAAGAAGGAAGG - Intergenic
974662377 4:64908965-64908987 CTAGGGATTAAGGAGAAGGAAGG - Intergenic
974802489 4:66836226-66836248 AAAGGGATAGAGAAGGAGGTTGG + Intergenic
974870225 4:67633612-67633634 GAAAGGTTAAAGAAGAAGGAAGG - Intronic
974925590 4:68294209-68294231 CAACGGATATATAGGAAGGAAGG - Intergenic
975035670 4:69677275-69677297 ATAGACATACAGAAGAAGGATGG + Intergenic
975098390 4:70484063-70484085 CATGGGAGACAGATGAAGGCTGG - Intergenic
975199312 4:71566678-71566700 CTAGGAATACTGAAGATGGAAGG + Intronic
975426551 4:74235711-74235733 CTAGGTATACAGAAGCAAGAAGG - Intronic
975700562 4:77062135-77062157 CAAGAGATACATAATAAGGCAGG - Intronic
975711531 4:77164865-77164887 CAAGGGAAATAGGAGAAAGATGG - Intronic
975794890 4:77996799-77996821 CAAGGGATGGAGAAGGAGTACGG + Intergenic
976499402 4:85770137-85770159 CAAAGAATACAGACCAAGGAAGG + Intronic
977143423 4:93404774-93404796 CAAGGAATAGATAAGAGGGAAGG + Intronic
977919221 4:102625194-102625216 AAAGGGAGAAAGAGGAAGGAGGG - Intergenic
977993776 4:103477776-103477798 CAAGGAATACAGAGGAAGATGGG + Intergenic
978475341 4:109122109-109122131 CAAGGGTTAGAGGAGAGGGAGGG + Intronic
978479049 4:109167636-109167658 CAAGGGAGAGAGAAGTAGGGAGG - Intronic
978604920 4:110468842-110468864 CAAAGCATTCAGAAGATGGAAGG + Intronic
978895261 4:113879112-113879134 CAAGGGAGACAGCAGAAGTGAGG - Intergenic
980500002 4:133637428-133637450 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982502360 4:156172923-156172945 AAAGGGATAAACAGGAAGGAAGG + Intergenic
982904506 4:161050502-161050524 CATGGGAGAAAGATGAAGGACGG + Intergenic
982959609 4:161820727-161820749 CAAAGGAGCCAGAAGATGGAAGG + Intronic
983197781 4:164826596-164826618 GAAGGGAGAGAGAGGAAGGAAGG + Intergenic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
983714578 4:170764227-170764249 CTAAGGATACAGAAGAAGCAAGG + Intergenic
984144664 4:176045747-176045769 CAAGGGCAAGAGAAGAAGGGAGG + Intergenic
984587956 4:181584404-181584426 TAAGGAATACAGAAGAAGCTTGG - Intergenic
985102235 4:186470002-186470024 CAAGGAAAAAAGAAGACGGAGGG + Intronic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
986058206 5:4160684-4160706 CATGGTATAAAGAAGAATGATGG - Intergenic
986698657 5:10382246-10382268 CAAGGGCTACAAAAGACGGCCGG + Intronic
986968346 5:13302455-13302477 CAAGGAACAAAGAAGAAGTACGG + Intergenic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987133295 5:14879113-14879135 TTAGGGATACAGGAGAAGGAGGG - Intergenic
987182174 5:15379643-15379665 AAAGGCAGAAAGAAGAAGGAAGG + Intergenic
988405167 5:30815007-30815029 CAAGGGAGACAGATGTAGGCTGG + Intergenic
989122898 5:38021766-38021788 GAAGAGATAGAGGAGAAGGAAGG - Intergenic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
990240344 5:53810704-53810726 CAAGGGCTGGAGAAGATGGATGG + Intergenic
990352528 5:54933285-54933307 CAAGGGAAAGAGAGGAAGGCAGG - Intergenic
990918110 5:60932871-60932893 AAAGGGAAAGAGAAGAGGGAAGG + Intronic
991195627 5:63929283-63929305 CAAGGGATGCAGAAGCAGCCAGG + Intergenic
991621530 5:68550297-68550319 CTAGGAAAACAGAAGAAGTAAGG + Intergenic
991724167 5:69519468-69519490 CAAGATATCCAGAAAAAGGAAGG - Intronic
994057456 5:95434348-95434370 CATGGAAAACACAAGAAGGAAGG - Intronic
994141668 5:96348231-96348253 GAAAGGTAACAGAAGAAGGAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994692774 5:103038177-103038199 AAAGGGATACAGAACAAAAATGG - Intergenic
995849145 5:116526132-116526154 CAAAGGATAAAAAAGAAGGGGGG - Intronic
995860280 5:116633866-116633888 CAAGGGATAGATAAGAAGCCTGG - Intergenic
995936812 5:117526721-117526743 CAAGGAAAAGAGAAGAAAGAAGG + Intergenic
996022572 5:118607729-118607751 CTAGTTGTACAGAAGAAGGAAGG - Intergenic
996489796 5:124080306-124080328 CATGGGATTCTGAAGAAAGAAGG - Intergenic
996980193 5:129482326-129482348 CAAGGTATACAGAAGAAAAAAGG + Intronic
997395587 5:133557416-133557438 TAAGGGACACAGAAGCAGGAAGG - Intronic
997778114 5:136629598-136629620 CAAGGGATGGGGAAGAGGGAAGG - Intergenic
997801609 5:136868303-136868325 CAAGGGCAGAAGAAGAAGGATGG - Intergenic
997880801 5:137587734-137587756 TACAGGAGACAGAAGAAGGAAGG - Intronic
998881222 5:146647302-146647324 CAAAGGAGACAGAAGAAACATGG - Intronic
999217457 5:149947139-149947161 CAAAGGATACAGATGAAGAGAGG - Intergenic
999524162 5:152384154-152384176 GAAAGGAAAGAGAAGAAGGAAGG - Intergenic
999574655 5:152962495-152962517 CAAGGCACAGAGAAGAAGCATGG - Intergenic
1000508106 5:162147338-162147360 AAAGAGAGACAGAGGAAGGAAGG - Intronic
1000871770 5:166585819-166585841 GAAGTCATACAGAAGAAGGTTGG + Intergenic
1001057011 5:168458021-168458043 CAAGGGAGGCAGTAGAAGCAAGG + Intronic
1001092904 5:168754447-168754469 GGAGGGAGACAGTAGAAGGATGG + Intronic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001482551 5:172098493-172098515 CACAGGATGCAGAGGAAGGATGG + Intronic
1001991514 5:176119845-176119867 CAAGGGAAAGATAGGAAGGAGGG - Intronic
1002225362 5:177718281-177718303 CAAGGGAAAGATAGGAAGGAGGG + Intronic
1002268482 5:178052833-178052855 CAAGGGAAAGATAGGAAGGAGGG - Intronic
1002905903 6:1449070-1449092 CAAAGGAGACAGCAGAAGGATGG - Intergenic
1003012048 6:2435461-2435483 AAAGAAATAAAGAAGAAGGAAGG - Intergenic
1003145977 6:3511102-3511124 CCATGGATTCAGAAGACGGAGGG + Intergenic
1003405139 6:5821652-5821674 CAAGAGAGAAAGTAGAAGGAGGG - Intergenic
1003599374 6:7503218-7503240 CATGGGATGCAGGAGAAGGGAGG - Intergenic
1003867984 6:10381056-10381078 GAAGGGAGGCAGAGGAAGGAAGG - Intergenic
1004737690 6:18424200-18424222 CCAGAGATACAGAAGAAGAGAGG + Intronic
1005677477 6:28169905-28169927 CACATGATACAGAAGAATGAGGG + Intergenic
1006346966 6:33490474-33490496 GGAGGGATACTGTAGAAGGAAGG + Intergenic
1006789054 6:36686710-36686732 GAAGGGACACACAAGAAGAAGGG + Exonic
1006790308 6:36696822-36696844 CCATGGTTGCAGAAGAAGGAAGG - Intergenic
1008041652 6:46807720-46807742 AGAGGAAAACAGAAGAAGGAGGG + Intronic
1009286803 6:61828671-61828693 CAAGGGGCAGAGAAGAATGAGGG - Intronic
1009752314 6:67888582-67888604 CAAGCCAGACAGAAGAAAGAGGG + Intergenic
1009890698 6:69677507-69677529 AAAGGGGAACAGAAGAAAGAAGG + Intronic
1010977523 6:82332543-82332565 GAGGGGATAGAGAAGAAGAAGGG - Intergenic
1012137769 6:95579698-95579720 CAAGAGATTCAGAAGCAGGGTGG - Intronic
1012924500 6:105254007-105254029 CAAGGGCAAGAGAAGATGGATGG - Intergenic
1013551476 6:111211844-111211866 CCAGGGATGGAGAAAAAGGAAGG - Intronic
1013576347 6:111486735-111486757 CAATGGCTAGAGAAGAGGGAAGG + Intergenic
1013724735 6:113080104-113080126 AAAGAGAGAGAGAAGAAGGAAGG + Intergenic
1013910477 6:115270928-115270950 GAAGGGAGACAAAAGAATGACGG - Intergenic
1014024171 6:116625727-116625749 CAAGGGAGTCAGAGGAAGCAAGG + Intronic
1014109546 6:117604848-117604870 CATGTAATACAGAAGAATGAAGG + Intergenic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014504939 6:122243190-122243212 AAAGGCACACTGAAGAAGGAAGG + Intergenic
1017124474 6:151052460-151052482 CAAGGGATACAGAAGAAGGATGG + Intronic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017828439 6:158101084-158101106 CCAGGGATTGAGAGGAAGGAGGG - Intergenic
1017956836 6:159185654-159185676 CAAGGGGTAAAAAAGGAGGAAGG + Intronic
1019393469 7:803022-803044 AAAGAGAGACAGAAGAAAGAAGG + Intergenic
1020025775 7:4898912-4898934 AAAGAGAGACAGAGGAAGGAAGG + Intergenic
1021063777 7:16146767-16146789 CAAAAGATAAAGAAAAAGGAAGG + Intronic
1022012414 7:26320367-26320389 CAAGGTAAACAGAAGTGGGATGG - Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1023911998 7:44562912-44562934 CAAAGGATACAGAAGATGGAGGG - Intergenic
1023942537 7:44779083-44779105 CATGGGAGAAAGATGAAGGAGGG + Intergenic
1024385258 7:48743768-48743790 CAAGGGATACAGACAAGTGAAGG - Intergenic
1024798473 7:53047987-53048009 CAAGGGATGGAGAAAAGGGAGGG + Intergenic
1024853925 7:53754651-53754673 AAAGGGAGATATAAGAAGGAAGG - Intergenic
1025111037 7:56216411-56216433 GAAGGGTTGCAGAAGGAGGAGGG + Intergenic
1027689820 7:81330386-81330408 CAAGGGATCCAGAAGGAAAAAGG - Intergenic
1028604454 7:92640401-92640423 CAATAGATACAAAAGAAGGATGG + Intronic
1029165294 7:98584982-98585004 AAAGGGAGACAGAGGAAGAAAGG - Intergenic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1030913166 7:115278362-115278384 CAAAGAACACTGAAGAAGGAGGG - Intergenic
1031279228 7:119775272-119775294 AAAGGGATAAAAAAGAAAGAAGG + Intergenic
1032411319 7:131694952-131694974 AAAGGGACACAGAATAAGTATGG - Intergenic
1033593679 7:142837682-142837704 AAAGAGAGAGAGAAGAAGGAAGG + Intergenic
1034896753 7:154881220-154881242 CAAGAGCTACAGCAGATGGATGG - Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036755850 8:11470659-11470681 CTAGGGATACAAGAGAAGGAAGG + Intronic
1036919372 8:12836648-12836670 CTAGTGATACAGAAGGGGGAAGG - Intergenic
1037468228 8:19181943-19181965 CAAGGCAAGAAGAAGAAGGATGG + Intergenic
1038105276 8:24426645-24426667 CATGTGACACAGAAGAAGGTAGG - Intergenic
1039160945 8:34618961-34618983 AAAGGGAAAGGGAAGAAGGAAGG + Intergenic
1039187163 8:34930401-34930423 AAAGAGAGAGAGAAGAAGGAGGG + Intergenic
1039346502 8:36711099-36711121 CAAGGCATACAGCAGAAGGAGGG - Intergenic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1041273208 8:56129956-56129978 CAGGAGATGGAGAAGAAGGAAGG + Intergenic
1041540832 8:58983016-58983038 GAAAGGCTGCAGAAGAAGGATGG - Intronic
1042335599 8:67627093-67627115 CAAAGGACAGAGAATAAGGAAGG + Intronic
1042823605 8:72957956-72957978 CAAGGGCCACATGAGAAGGAAGG + Intergenic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1043815774 8:84799414-84799436 AAAGAAATACTGAAGAAGGAAGG + Intronic
1044301597 8:90590889-90590911 GAAGGGAAAAAGAAAAAGGAAGG + Intergenic
1044893487 8:96862848-96862870 GAAGTGATAAAGAAGAAGGTGGG - Intronic
1045004139 8:97902726-97902748 CAAGGGAGACAGGAGAGGTAAGG - Intronic
1045015035 8:97994123-97994145 GAAGGGAGAGAGAGGAAGGAAGG + Intronic
1046177499 8:110597399-110597421 CAAAAGATACAAAAGAAAGAAGG + Intergenic
1046578612 8:116063773-116063795 CAAGGGATTCAGAACAAGATTGG - Intergenic
1046984314 8:120370485-120370507 GCAGGGATGCAGAAGAAGCAGGG - Intronic
1047039208 8:120974208-120974230 GAAAGGAGACAGAAAAAGGAAGG + Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1048171086 8:132107103-132107125 AAATAGATACAGAAGAAGAAGGG - Intronic
1048722737 8:137345060-137345082 CAAGGGAAACAAAGGAAAGAAGG - Intergenic
1048754507 8:137722049-137722071 CTAGGGGTATGGAAGAAGGAAGG + Intergenic
1051664327 9:19454464-19454486 CAAGGGATAAAGAGCCAGGAAGG - Intergenic
1051861410 9:21628992-21629014 CAAGGCAGGCAAAAGAAGGAGGG + Intergenic
1052210877 9:25901823-25901845 AAGGGGCTACAGAGGAAGGAAGG + Intergenic
1054746187 9:68856249-68856271 CCAGGGATAGAGAAGCAGTAAGG - Intronic
1054770240 9:69076819-69076841 CAAGGGAGAAAGGGGAAGGAGGG + Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055864840 9:80800694-80800716 AAAAGTATCCAGAAGAAGGATGG - Intergenic
1056045783 9:82714145-82714167 GGAGGGACACTGAAGAAGGATGG - Intergenic
1056879332 9:90375742-90375764 CAAGGGAAAAAGAAAAAAGACGG + Intergenic
1058115434 9:101079388-101079410 GAAAGGATACACAAGAGGGAAGG + Intronic
1058596410 9:106620719-106620741 CAATGGAAAGACAAGAAGGAGGG + Intergenic
1059352944 9:113678489-113678511 GAAGGGAAACGGAGGAAGGAAGG - Intergenic
1059602536 9:115795720-115795742 AAAGGCATACAGAAGATGGTGGG + Intergenic
1059807879 9:117823910-117823932 GAAGGGTTGGAGAAGAAGGAAGG + Intergenic
1060187961 9:121575352-121575374 CCAGGACCACAGAAGAAGGAAGG - Intronic
1061307435 9:129740177-129740199 CAAGGGCTAGAGAGGAAGGTGGG - Intronic
1185764555 X:2715111-2715133 GAAGAGCTGCAGAAGAAGGAAGG - Intronic
1186944449 X:14549901-14549923 CAAGGGATACAGAGAAAGAGTGG + Intronic
1186962611 X:14752935-14752957 CCAGAGACAGAGAAGAAGGAAGG - Intergenic
1187044104 X:15629038-15629060 CTAGGCAACCAGAAGAAGGAGGG + Intronic
1188005668 X:25014235-25014257 AAAGGAATAAAGAAGAAAGAAGG - Intronic
1188740250 X:33769281-33769303 CAAGGGGGAGAGAAGAAGCAGGG + Intergenic
1188786531 X:34353366-34353388 CACGGGAGAAAGAAGAAGGTTGG - Intergenic
1188948136 X:36333901-36333923 AAAGGGATACTGAGGAAGCAAGG - Intronic
1189497130 X:41518953-41518975 CAAGGGATACAGCAAGAGGAAGG + Intronic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1191715580 X:64191607-64191629 CAATGGAGACAGAGGAAGAACGG - Exonic
1191842409 X:65522643-65522665 CAAGGGATGCAGGAAATGGAGGG + Intronic
1193461745 X:81798327-81798349 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1194233170 X:91348931-91348953 CAAGGGAGAAAGATGAAGGCTGG - Intergenic
1194572430 X:95569489-95569511 TAATGGAGATAGAAGAAGGATGG + Intergenic
1195198281 X:102520116-102520138 CAAGGGAGAAAGATGAAGGCCGG + Intergenic
1195545946 X:106112914-106112936 TAAGAGAGACAGAAGATGGAGGG + Intergenic
1195565314 X:106333236-106333258 CAAGAGAGAGAGAAGAATGAAGG - Intergenic
1196228593 X:113194584-113194606 AAAGTCATACAGAAGAAAGATGG + Intergenic
1196303211 X:114069795-114069817 TGAGGGCTACAGAAGCAGGAAGG - Intergenic
1196416342 X:115475771-115475793 CCAGTGAGACAGAAGAAGGTGGG - Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196817524 X:119677158-119677180 CAAGGGACCCAGAGGAAGCACGG - Intronic
1196834502 X:119801986-119802008 GAAGGGAAAGAGAAGAAGGAAGG - Intergenic
1196861380 X:120031644-120031666 CAAGGTTTACAGAAGGAGGGAGG + Intergenic
1196999401 X:121422028-121422050 CATAGGATACTGAAGTAGGAAGG - Intergenic
1197346988 X:125336191-125336213 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1198562980 X:137871405-137871427 CCAGGGATACAGAGAGAGGATGG - Intergenic
1198731529 X:139735518-139735540 CAAGGAATACAGAACAAAGTAGG + Intronic
1199271188 X:145884002-145884024 TAAGGGGTACTGAAAAAGGATGG - Intergenic
1200326434 X:155245176-155245198 CATTGGATACATAAGGAGGAGGG - Intergenic
1200946150 Y:8840559-8840581 CAAGGAATACAAAACAAGAAGGG + Intergenic
1200953661 Y:8924804-8924826 GAAGGGAGAGAGAGGAAGGAAGG - Intergenic
1201300169 Y:12498414-12498436 CAAGAGAGAAAGAGGAAGGAGGG - Intergenic
1201550577 Y:15212774-15212796 CAAGGGAGATGAAAGAAGGAAGG + Intergenic
1201625599 Y:16011709-16011731 GAAGGGAGAAAGAGGAAGGAAGG + Intergenic
1201741302 Y:17326645-17326667 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic