ID: 1017124552

View in Genome Browser
Species Human (GRCh38)
Location 6:151052916-151052938
Sequence ATTTGTCCCTTTATTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017124552_1017124553 10 Left 1017124552 6:151052916-151052938 CCAGGCTGAATAAAGGGACAAAT 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1017124553 6:151052949-151052971 TGCACTGAGATCGCCCGTCGTGG No data
1017124552_1017124556 15 Left 1017124552 6:151052916-151052938 CCAGGCTGAATAAAGGGACAAAT 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1017124556 6:151052954-151052976 TGAGATCGCCCGTCGTGGGGTGG No data
1017124552_1017124557 16 Left 1017124552 6:151052916-151052938 CCAGGCTGAATAAAGGGACAAAT 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1017124557 6:151052955-151052977 GAGATCGCCCGTCGTGGGGTGGG No data
1017124552_1017124554 11 Left 1017124552 6:151052916-151052938 CCAGGCTGAATAAAGGGACAAAT 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1017124554 6:151052950-151052972 GCACTGAGATCGCCCGTCGTGGG No data
1017124552_1017124555 12 Left 1017124552 6:151052916-151052938 CCAGGCTGAATAAAGGGACAAAT 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017124552 Original CRISPR ATTTGTCCCTTTATTCAGCC TGG (reversed) Intronic
903602705 1:24554182-24554204 CTTTGTCCCTTAATCCAGGCTGG - Intergenic
904985623 1:34546133-34546155 ATTTTTCCCTTTCTTCCCCCAGG + Intergenic
905498757 1:38419073-38419095 TTTTGCCCCTTTAATGAGCCTGG - Intergenic
905908292 1:41634562-41634584 TTTTTTCCTTTTATCCAGCCTGG - Intronic
906560459 1:46752926-46752948 ATTTGTGGCTTTGTTCAGCCTGG + Intergenic
907882303 1:58562256-58562278 ATTATTCCCTTTGATCAGCCTGG - Intergenic
909372348 1:74898503-74898525 ATTTCTCCCTTTTATCAGTCAGG - Intergenic
909850575 1:80457971-80457993 TGTTGTCCCTTTTCTCAGCCAGG - Intergenic
910103617 1:83605797-83605819 AATTGTCGCTTTATTTATCCAGG - Intergenic
916290841 1:163164681-163164703 ATTTGTGGCTTTCATCAGCCAGG - Intronic
917625043 1:176837156-176837178 ATTTGTCCATTTCATCTGCCTGG + Intronic
921504035 1:215944376-215944398 ATTGCTCCCTTTATTCAGGAAGG - Intronic
921755667 1:218853349-218853371 ATTTGTAAGTGTATTCAGCCTGG - Intergenic
922031633 1:221806581-221806603 AATTGTCCCTATTTCCAGCCTGG + Intergenic
922920920 1:229302730-229302752 TTTTTTCCCTTTATTCAGAATGG + Intronic
923145256 1:231193199-231193221 ATTTTGCTTTTTATTCAGCCGGG + Intronic
923916943 1:238517992-238518014 ATGTGTCCCTTTATTTAGAAGGG + Intergenic
1062928701 10:1338198-1338220 ATTTCTCCTTTTATTCATGCTGG + Intronic
1063822230 10:9849733-9849755 AATTGTCCCTATATTCAGAATGG + Intergenic
1063856774 10:10263968-10263990 CTTTGTCCCTGAATTCAGACTGG + Intergenic
1065202445 10:23326786-23326808 TTTTGACCCTTTGTTCAGCAAGG - Intronic
1071900151 10:90112114-90112136 CTTTTTCCCTTTCTTAAGCCAGG + Intergenic
1073152891 10:101323717-101323739 CTTTCTCCCTCTACTCAGCCAGG + Intergenic
1074153584 10:110779809-110779831 GTTTGTGCCTATATTCAGACAGG + Intronic
1074388417 10:113035961-113035983 ATTTGTCCCTTTATTTGTTCAGG - Intronic
1082190188 11:49233797-49233819 ACTTGTCCCTTTTTACAGTCAGG + Intergenic
1086675936 11:89607111-89607133 ACTTGTCCCTTTTTACAGTCAGG - Intergenic
1088167758 11:106957833-106957855 GTTTGTCCCTTTGCTCAGACTGG - Intronic
1090952925 11:131489330-131489352 CCTTATCCCTTTATTCAACCCGG + Intronic
1091677978 12:2505090-2505112 ATCTGACCCTTTACCCAGCCAGG - Intronic
1091773107 12:3166542-3166564 TTCTGTCCATTTATTCATCCCGG - Intronic
1092920702 12:13229313-13229335 ATTTCTGACTTTTTTCAGCCAGG + Intergenic
1093768506 12:22993245-22993267 ATTTGTCACTCTATTCAGCCAGG + Intergenic
1096997770 12:55849713-55849735 ATTTATCCCTTCATGCATCCTGG + Intergenic
1097101081 12:56589992-56590014 AGTTGTCTCTTTAGTAAGCCTGG - Exonic
1106588674 13:31079352-31079374 TTTTGTTGCTTTATTCAGGCTGG - Intergenic
1108436935 13:50410189-50410211 ATTTGTCCCTGTATTGGCCCAGG + Intronic
1112270877 13:97968507-97968529 ATTTCTCCCTTAATTCTGTCAGG + Intronic
1112611724 13:100961737-100961759 ATATATGCCTTTATTCATCCTGG + Intergenic
1116744848 14:48804890-48804912 ATTGGTCCATTTATTTAGGCAGG + Intergenic
1116758450 14:48979092-48979114 ATTTTTCTCTTTCTTCTGCCTGG + Intergenic
1120279827 14:82425028-82425050 TTTTGTACCTTTATTCACCAGGG - Intergenic
1120428000 14:84375280-84375302 ATTGGTCCCTTAATTCATCTTGG - Intergenic
1120572875 14:86143652-86143674 ATTTGCTCCTTTTTACAGCCAGG - Intergenic
1120856618 14:89217965-89217987 ATTTGTACCTTTTTCCAGCCTGG + Intronic
1125003847 15:34796403-34796425 ATTTGTTCCTTTATTCACTTTGG - Intergenic
1129699937 15:77762054-77762076 ATTCGGCCCTTAATTCACCCTGG + Intronic
1131364554 15:91827373-91827395 ATCTGTTCCTTTCTTGAGCCAGG - Intergenic
1131521470 15:93119288-93119310 ATGTGACTTTTTATTCAGCCGGG + Intergenic
1131767039 15:95688987-95689009 ATTTGTCTCTGTATTCATGCAGG - Intergenic
1134567764 16:15265953-15265975 GTTTCTCCCTTTATAAAGCCAGG - Intergenic
1134734672 16:16490400-16490422 GTTTCTCCCTTTATAAAGCCAGG + Intergenic
1134932801 16:18221506-18221528 GTTTCTCCCTTTATAAAGCCAGG - Intergenic
1135089401 16:19500982-19501004 ATTTTACCTTTGATTCAGCCAGG - Intergenic
1138074182 16:54024674-54024696 ATTATTCCCTTTATTCAGATGGG - Intronic
1146252651 17:31363046-31363068 GTTGGTGCCTTTATTCAGGCTGG + Intronic
1146562817 17:33886180-33886202 CTTTGTCCATCTCTTCAGCCAGG - Intronic
1147489171 17:40847964-40847986 ATTTGTCTATTTATCCAGTCTGG - Intergenic
1149183107 17:53964019-53964041 AATTTTCCTTTTATTTAGCCAGG + Intergenic
1149622164 17:58053963-58053985 AATTTTGCCTTTATTCATCCTGG - Intergenic
1153154874 18:2137002-2137024 ATTTGTACTTTTAGTAAGCCTGG - Intergenic
1154472004 18:14712656-14712678 CTTGGTACCTTCATTCAGCCTGG - Intergenic
1156170532 18:34479106-34479128 ATTTGTACCTTCATTCACCAGGG + Intergenic
1160256551 18:77252095-77252117 GTTTTTCCCTTTGTACAGCCGGG + Intronic
1161415287 19:4143318-4143340 ATTTATTTATTTATTCAGCCAGG - Intergenic
928361565 2:30666121-30666143 ACTTCTCCCCTTACTCAGCCTGG - Intergenic
930937579 2:56973521-56973543 ATTTGCACCTTTATTCATCATGG - Intergenic
933804904 2:85991234-85991256 ATTTGGCCATGTATTCACCCAGG - Intergenic
935644581 2:105323564-105323586 ATTTGGCTCTTCATTCAGTCAGG - Intronic
937497562 2:122438426-122438448 ATTTGTCCATTTGTTCTACCGGG - Intergenic
937535774 2:122885159-122885181 ATGTTTCTCATTATTCAGCCTGG - Intergenic
948343182 2:237271389-237271411 ATTTTTCATTTTATTTAGCCTGG - Intergenic
1169829090 20:9803428-9803450 ATTTGTCCCTATATTCTCTCAGG - Intronic
1170987162 20:21268980-21269002 ATTTCTCCATGTATCCAGCCTGG - Intergenic
1171793686 20:29550189-29550211 ACTTGTCCCTTTAGTCAGTAAGG + Intergenic
1174107699 20:48174584-48174606 ATATGTCCCTTTATTTCCCCAGG + Intergenic
1175858777 20:62137952-62137974 ATTAGTGTCTTTATCCAGCCGGG - Intronic
1176669683 21:9721394-9721416 ATTTTTTCCTATATTTAGCCTGG - Intergenic
1176897569 21:14400001-14400023 ATTTGGGCCTTTAATCAACCTGG + Intergenic
1177598884 21:23284787-23284809 AAATGTAACTTTATTCAGCCTGG - Intergenic
1178233721 21:30817961-30817983 ACTTGTCCCATTTTTCAGTCGGG - Intergenic
1179456781 21:41506027-41506049 ATGTGGCACTTTTTTCAGCCAGG - Intronic
949518729 3:4830465-4830487 ATTTGTCCCTTTTATGAGCTAGG - Intronic
951811577 3:26706356-26706378 TTTTGTCACTTTATTCTGGCTGG + Intronic
955953875 3:64268187-64268209 AGGTGTCCCTTTAAGCAGCCGGG - Intronic
956764151 3:72469980-72470002 ATATGTCCCCTGATTCATCCTGG + Intergenic
956807421 3:72829144-72829166 ATTTTTCACTCTATTCACCCAGG - Intronic
956865668 3:73366460-73366482 ATTTGCTGCTTTAGTCAGCCTGG + Intergenic
958825401 3:99024016-99024038 ATTTGACCATGTCTTCAGCCTGG + Intergenic
960492842 3:118338098-118338120 ATTGGTTCCTGTATTCACCCTGG - Intergenic
963991484 3:151661376-151661398 ATTATGCCCTTTACTCAGCCTGG - Intergenic
964598656 3:158469185-158469207 ACTTGTCTCTTTACTAAGCCAGG + Intronic
966220292 3:177544721-177544743 ATTATTCTCTTTATTCAGCTGGG + Intergenic
967348795 3:188488973-188488995 ATTTCTTCCTCTTTTCAGCCAGG + Intronic
968938802 4:3627330-3627352 ATCAGCCCCTTTATTCAACCAGG - Intergenic
970424539 4:15934045-15934067 ATTTGTCCCTTCTTTTTGCCAGG - Intergenic
971148375 4:24004778-24004800 ATCTGTCTCTTTATGAAGCCTGG - Intergenic
971587911 4:28429180-28429202 TTTTGTGCCTTTATTCATCGTGG + Intergenic
972840643 4:42926264-42926286 ATTTTTACCTGTATTCACCCAGG - Intronic
975596689 4:76053434-76053456 ATTTGTCTCTTTTTTCAACCTGG + Intronic
976860777 4:89663534-89663556 ATTTCTGCCTTTAGTCATCCTGG + Intergenic
978421131 4:108533953-108533975 ATTTGTCCATTTCTTCAGTGAGG + Intergenic
981963315 4:150568875-150568897 AGTTATCCCTTTTTTCAACCAGG - Intronic
983274518 4:165601324-165601346 ACTTGCCTCTTTATTCATCCAGG + Intergenic
985405096 4:189630076-189630098 ATTTTTTCCTATATTTAGCCTGG + Intergenic
986243334 5:5981312-5981334 ATTAGTCCCTTGATCCCGCCAGG + Intergenic
990512606 5:56502326-56502348 ATTTGTGCCTATATTTAGACTGG - Intergenic
993137276 5:83985082-83985104 ATTTTTCCTTTTATTTAGGCTGG - Intronic
993883100 5:93385631-93385653 ATTGGTCCCTTTAGAAAGCCAGG + Intergenic
996475305 5:123912433-123912455 ATGTGTCCCTTTATGCTGTCTGG + Intergenic
999511625 5:152258221-152258243 ATTTCTCCCATTACTAAGCCTGG - Intergenic
1002511735 5:179724547-179724569 ATCTATCCCTGTATACAGCCTGG + Intronic
1002704768 5:181153057-181153079 GTTTGTCCCTTTAGCCATCCGGG - Intergenic
1005190681 6:23218983-23219005 ATTTGTCCTTTAATTGAGCTGGG + Intergenic
1006242936 6:32702125-32702147 ACATGTCCTTATATTCAGCCAGG + Intergenic
1009787990 6:68363036-68363058 ATTTCCCCCATAATTCAGCCAGG + Intergenic
1012119570 6:95347919-95347941 ATTTGTCCCATGAATCATCCAGG + Intergenic
1012233531 6:96787064-96787086 ATTTGACCCTTTCTGTAGCCTGG - Intergenic
1012961096 6:105622680-105622702 ATTTTTCCTTTTACTCATCCCGG - Intergenic
1013527151 6:110985080-110985102 ATTTCCCCCTTTAATCAGCATGG - Exonic
1014278127 6:119410579-119410601 ATTTATACCTTTATTCTACCTGG - Intergenic
1016178152 6:141106560-141106582 ATTTTTCCCTCTATTCATCATGG - Intergenic
1017124552 6:151052916-151052938 ATTTGTCCCTTTATTCAGCCTGG - Intronic
1017260800 6:152384373-152384395 ATCTATCCATTTATTCAGCCAGG - Intronic
1020572377 7:9881424-9881446 ATTTGTTCATTTATTCACACAGG + Intergenic
1022262767 7:28722370-28722392 ATTTGACCCCTTATTCCGACTGG - Intronic
1027940135 7:84667741-84667763 ATTTGTACCTTTATTCTGTGAGG - Intergenic
1029177279 7:98673880-98673902 ATTTCTTCCTTTATTCTGCCTGG - Intergenic
1030356409 7:108548147-108548169 TATTGTCCCATTATTCAGGCAGG - Intronic
1033058420 7:138081438-138081460 CTTTCTTCCTTTATCCAGCCAGG + Intronic
1033704623 7:143874912-143874934 ATTCATCCATTTATTTAGCCAGG - Intronic
1033919614 7:146373640-146373662 ATTTTTTCCTTTATTCTTCCAGG - Intronic
1034243801 7:149629096-149629118 ATTTGTCCCCTTTTTCATCCAGG + Intergenic
1034368219 7:150570306-150570328 TTCTGCCCCTTTCTTCAGCCTGG + Intronic
1035108328 7:156460272-156460294 AGGTGTCCCTTTATCCACCCAGG - Intergenic
1037268378 8:17095593-17095615 CTTAGACCCTTTATTCAGACAGG + Intronic
1039031588 8:33315591-33315613 ATTTTTCCCTTTCTTCAGATTGG - Intergenic
1039739091 8:40363453-40363475 ATTTGTTCCTTTATTCACCAGGG + Intergenic
1041517976 8:58723569-58723591 ATTTTAACCTTAATTCAGCCAGG + Intergenic
1042879096 8:73467609-73467631 ATTTGTCCCCTTTTACAGCTAGG + Intronic
1043685084 8:83074398-83074420 ATTTGTCACTTTAGTCAGATGGG - Intergenic
1047280876 8:123444493-123444515 ATTTTTTGCTTTAGTCAGCCAGG - Intronic
1052351165 9:27459523-27459545 ATTCATTCCTTTACTCAGCCAGG - Intronic
1053243243 9:36514072-36514094 ATTTGACCCTTTGTTAATCCAGG - Intergenic
1056690233 9:88801993-88802015 ATTTCTCCCTATAAACAGCCCGG - Intergenic
1057562407 9:96138921-96138943 ACTTGTCACGTTATTCAACCTGG - Intergenic
1058131710 9:101260867-101260889 ATTTTCCCTTTTCTTCAGCCTGG - Intronic
1060263822 9:122098050-122098072 ATTTGTCTCTATATTCTTCCAGG - Intergenic
1062160635 9:135077714-135077736 ATGTGTCCCTTGACTCAGCCAGG + Intronic
1186568264 X:10687293-10687315 ATTTCTCCCTTTTTCCTGCCTGG + Intronic
1188124811 X:26354136-26354158 AATTATGACTTTATTCAGCCTGG + Intergenic
1188720831 X:33521208-33521230 ATTTATACCTGTATTCAGTCTGG - Intergenic
1192392328 X:70743217-70743239 ATTTCTTTCTTTATTAAGCCAGG + Intronic
1193559908 X:83005886-83005908 TTTTGTCCAGTTATTCAGACTGG + Intergenic
1196737065 X:118989386-118989408 ATGTGGCCCTTTCTTCATCCAGG + Exonic
1197932572 X:131710971-131710993 ATTTGTCCATTGATTGTGCCAGG + Intergenic