ID: 1017124555

View in Genome Browser
Species Human (GRCh38)
Location 6:151052951-151052973
Sequence CACTGAGATCGCCCGTCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017124552_1017124555 12 Left 1017124552 6:151052916-151052938 CCAGGCTGAATAAAGGGACAAAT 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017124555 Original CRISPR CACTGAGATCGCCCGTCGTG GGG Intronic
923293857 1:232573738-232573760 CACTGAGAGCGGCCGTTGTGAGG - Intergenic
1102240248 12:111320547-111320569 CCTTGAGCTCGCCCGTCCTGGGG - Exonic
1107353043 13:39536334-39536356 CACTCAGATCTCCCTTCGAGAGG + Intronic
1154353113 18:13603643-13603665 CACTGAGATGGCGCTTCCTGTGG - Intronic
947229548 2:227871445-227871467 CTCTGAGGTCGCCCTTAGTGAGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1180055615 21:45357823-45357845 CCCTGAGAGTGCCCGGCGTGTGG - Intergenic
1185119201 22:48955804-48955826 CACTGAGAGGTGCCGTCGTGGGG - Intergenic
985499349 5:231874-231896 CACTGAGAGAGCTTGTCGTGGGG + Intronic
1003137905 6:3446997-3447019 CAGTGAGATCTCGCGTGGTGGGG - Intronic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1019912045 7:4106647-4106669 CTCTGAGAACGCCGGGCGTGCGG - Intronic
1023959656 7:44915918-44915940 CCCTGAGATCTCCCGTCAGGAGG - Intergenic
1029226920 7:99035046-99035068 CACTGAGGTCGCCGGAAGTGGGG - Intronic
1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG + Intergenic
1185809218 X:3089553-3089575 CAGTGAAATCGTCCGTGGTGGGG - Exonic
1197753239 X:129979894-129979916 CACTGAGGTCGCCCAGGGTGGGG + Intergenic
1200109813 X:153734662-153734684 CACTGATGTCGCCCCTCCTGGGG - Intronic