ID: 1017126344

View in Genome Browser
Species Human (GRCh38)
Location 6:151067866-151067888
Sequence TGTCCCCATGACATCGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126344_1017126350 19 Left 1017126344 6:151067866-151067888 CCCCTGCCGATGTCATGGGGACA 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126344_1017126351 27 Left 1017126344 6:151067866-151067888 CCCCTGCCGATGTCATGGGGACA 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1017126351 6:151067916-151067938 ACGTAATGCATGTGGACTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126344 Original CRISPR TGTCCCCATGACATCGGCAG GGG (reversed) Intronic