ID: 1017126345

View in Genome Browser
Species Human (GRCh38)
Location 6:151067867-151067889
Sequence GTGTCCCCATGACATCGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126345_1017126351 26 Left 1017126345 6:151067867-151067889 CCCTGCCGATGTCATGGGGACAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1017126351 6:151067916-151067938 ACGTAATGCATGTGGACTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 67
1017126345_1017126350 18 Left 1017126345 6:151067867-151067889 CCCTGCCGATGTCATGGGGACAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126345 Original CRISPR GTGTCCCCATGACATCGGCA GGG (reversed) Intronic