ID: 1017126345 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:151067867-151067889 |
| Sequence | GTGTCCCCATGACATCGGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 81 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 8, 4: 72} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017126345_1017126351 | 26 | Left | 1017126345 | 6:151067867-151067889 | CCCTGCCGATGTCATGGGGACAC | 0: 1 1: 0 2: 0 3: 8 4: 72 |
||
| Right | 1017126351 | 6:151067916-151067938 | ACGTAATGCATGTGGACTTCTGG | 0: 1 1: 0 2: 0 3: 4 4: 67 |
||||
| 1017126345_1017126350 | 18 | Left | 1017126345 | 6:151067867-151067889 | CCCTGCCGATGTCATGGGGACAC | 0: 1 1: 0 2: 0 3: 8 4: 72 |
||
| Right | 1017126350 | 6:151067908-151067930 | TGTGTCTCACGTAATGCATGTGG | 0: 1 1: 0 2: 0 3: 3 4: 105 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017126345 | Original CRISPR | GTGTCCCCATGACATCGGCA GGG (reversed) | Intronic | ||