ID: 1017126346

View in Genome Browser
Species Human (GRCh38)
Location 6:151067868-151067890
Sequence GGTGTCCCCATGACATCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126346_1017126351 25 Left 1017126346 6:151067868-151067890 CCTGCCGATGTCATGGGGACACC No data
Right 1017126351 6:151067916-151067938 ACGTAATGCATGTGGACTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 67
1017126346_1017126350 17 Left 1017126346 6:151067868-151067890 CCTGCCGATGTCATGGGGACACC No data
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126346 Original CRISPR GGTGTCCCCATGACATCGGC AGG (reversed) Intronic