ID: 1017126346 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:151067868-151067890 |
Sequence | GGTGTCCCCATGACATCGGC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1017126346_1017126351 | 25 | Left | 1017126346 | 6:151067868-151067890 | CCTGCCGATGTCATGGGGACACC | No data | ||
Right | 1017126351 | 6:151067916-151067938 | ACGTAATGCATGTGGACTTCTGG | 0: 1 1: 0 2: 0 3: 4 4: 67 |
||||
1017126346_1017126350 | 17 | Left | 1017126346 | 6:151067868-151067890 | CCTGCCGATGTCATGGGGACACC | No data | ||
Right | 1017126350 | 6:151067908-151067930 | TGTGTCTCACGTAATGCATGTGG | 0: 1 1: 0 2: 0 3: 3 4: 105 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1017126346 | Original CRISPR | GGTGTCCCCATGACATCGGC AGG (reversed) | Intronic | ||