ID: 1017126348

View in Genome Browser
Species Human (GRCh38)
Location 6:151067889-151067911
Sequence CACATCAGAGTTCATTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126348_1017126350 -4 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126348_1017126352 20 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126352 6:151067932-151067954 CTTCTGGTGCATGTAAACAGAGG 0: 1
1: 0
2: 1
3: 7
4: 103
1017126348_1017126353 21 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126353 6:151067933-151067955 TTCTGGTGCATGTAAACAGAGGG No data
1017126348_1017126354 24 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126354 6:151067936-151067958 TGGTGCATGTAAACAGAGGGTGG No data
1017126348_1017126351 4 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126351 6:151067916-151067938 ACGTAATGCATGTGGACTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126348 Original CRISPR CACATCAGAGTTCATTTGGC TGG (reversed) Intronic