ID: 1017126349

View in Genome Browser
Species Human (GRCh38)
Location 6:151067893-151067915
Sequence GAGACACATCAGAGTTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126349_1017126352 16 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126352 6:151067932-151067954 CTTCTGGTGCATGTAAACAGAGG 0: 1
1: 0
2: 1
3: 7
4: 103
1017126349_1017126351 0 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126351 6:151067916-151067938 ACGTAATGCATGTGGACTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 67
1017126349_1017126353 17 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126353 6:151067933-151067955 TTCTGGTGCATGTAAACAGAGGG No data
1017126349_1017126354 20 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126354 6:151067936-151067958 TGGTGCATGTAAACAGAGGGTGG No data
1017126349_1017126350 -8 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126349 Original CRISPR GAGACACATCAGAGTTCATT TGG (reversed) Intronic