ID: 1017126350

View in Genome Browser
Species Human (GRCh38)
Location 6:151067908-151067930
Sequence TGTGTCTCACGTAATGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126349_1017126350 -8 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126348_1017126350 -4 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126344_1017126350 19 Left 1017126344 6:151067866-151067888 CCCCTGCCGATGTCATGGGGACA 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126346_1017126350 17 Left 1017126346 6:151067868-151067890 CCTGCCGATGTCATGGGGACACC 0: 1
1: 0
2: 0
3: 2
4: 50
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126345_1017126350 18 Left 1017126345 6:151067867-151067889 CCCTGCCGATGTCATGGGGACAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126347_1017126350 13 Left 1017126347 6:151067872-151067894 CCGATGTCATGGGGACACCAGCC 0: 1
1: 0
2: 0
3: 15
4: 135
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126350 Original CRISPR TGTGTCTCACGTAATGCATG TGG Intronic
907338824 1:53719026-53719048 AGTGTCCCACGGGATGCATGCGG - Intronic
912310049 1:108611021-108611043 TGTGTCTGACTTATTGCATTTGG + Intronic
913121138 1:115741943-115741965 TGTGTCCCAAGGCATGCATGAGG + Intronic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
915955700 1:160218338-160218360 TCTGTCTCAGGTGATGCATAAGG + Exonic
918902987 1:190450037-190450059 TGTGTCTCAAATATTACATGGGG + Intronic
922052930 1:222011508-222011530 TGTGTCTCCCCTAAAACATGTGG - Intergenic
1064634482 10:17349879-17349901 TGTGTTTTATGTAATGCATCAGG - Intronic
1064900376 10:20289543-20289565 TGTGCCTCAGGTAATTTATGTGG + Exonic
1066323282 10:34327304-34327326 TGTGTCTCATTTAATCCATCTGG - Intronic
1066478988 10:35777230-35777252 TGTGGCTCACTTAGTGCCTGCGG - Intergenic
1069348198 10:67494980-67495002 TATGTCTCAAATATTGCATGGGG - Intronic
1071679160 10:87687010-87687032 TATGTCTCAAATATTGCATGGGG + Intronic
1073156520 10:101351472-101351494 TCTGGCTCAGGTAATGAATGAGG - Intergenic
1073374990 10:103025879-103025901 TGTGTCTCACAAAGTTCATGTGG + Intronic
1078062469 11:8056839-8056861 TGTGTCTCAAGTAAGGTGTGGGG + Intronic
1078949386 11:16112411-16112433 TATGTTTAACATAATGCATGAGG - Intronic
1079095007 11:17504417-17504439 TGTTTCTCAGCTCATGCATGGGG + Intronic
1081432275 11:42989513-42989535 TGTGTCTCTCTTTATTCATGAGG + Intergenic
1084734685 11:71097039-71097061 TGTGTCTCACGTGCAGGATGGGG + Intronic
1085927108 11:81035546-81035568 TGCTTCTCACCTAATTCATGGGG - Intergenic
1086515005 11:87601636-87601658 TATGTCCCAAGTACTGCATGAGG + Intergenic
1090665251 11:128910898-128910920 TGTGTCCCACGCATTACATGTGG - Intronic
1092476986 12:8828070-8828092 TGTGTCTCACCCAAGGCCTGTGG + Intronic
1093534150 12:20202723-20202745 TCTGCCTCACCCAATGCATGGGG - Intergenic
1097816897 12:64084515-64084537 TGTGTCTCAACTGATGAATGAGG - Intronic
1098779876 12:74673448-74673470 TGTGTCTCATGTACTCCCTGAGG - Intergenic
1099258014 12:80340174-80340196 TGTGTCTGACATTATGCTTGAGG + Intronic
1099259075 12:80353834-80353856 TGAGTCTCAGGTTATGCATCTGG + Intronic
1099763428 12:86950360-86950382 TTTGTCTCACCTAATTGATGTGG + Intergenic
1101450958 12:104778512-104778534 AGTGTCTCAATAAATGCATGTGG - Intergenic
1102793000 12:115663454-115663476 TGTGTCCCACATATTGCATAGGG - Intergenic
1107271433 13:38622461-38622483 TGTGTCACACGTCATGGATCAGG - Intergenic
1111095291 13:83505954-83505976 TGTGTCTCATTAAATGCAAGAGG + Intergenic
1111138124 13:84078149-84078171 TGTGTCTCACTTATTTCACGTGG - Intergenic
1112544428 13:100352250-100352272 TGTGTCTCTTGTAAAGCATATGG - Intronic
1113499917 13:110765089-110765111 TGTGTCCCAGGTAATGCAGTGGG + Intergenic
1116162363 14:41285406-41285428 TGTAACTCACATAATTCATGTGG - Intergenic
1116872862 14:50084299-50084321 TATGTCCCACATACTGCATGGGG + Intronic
1117196636 14:53346172-53346194 AGTGACCCACGTAATGCATCTGG + Intergenic
1117386187 14:55215363-55215385 TATGTCTCAGATATTGCATGAGG - Intergenic
1120140357 14:80923826-80923848 GGTCTCTCACTAAATGCATGGGG - Intronic
1124115602 15:26840297-26840319 TGTGTCTCTTGTAAACCATGTGG - Intronic
1126281535 15:46957129-46957151 TATGTCCCAAGTATTGCATGGGG - Intergenic
1133561156 16:6951665-6951687 TGTGACTCACTGAATCCATGAGG - Intronic
1134079566 16:11315695-11315717 TCTGTCTCAGGAAATGCGTGTGG + Intronic
1134158919 16:11868546-11868568 TCAGTTTCACCTAATGCATGTGG + Exonic
1140957301 16:79877392-79877414 TGTGTCTCAGGCACTGCTTGTGG - Intergenic
1141035082 16:80619541-80619563 TGCTTCTCTCGTCATGCATGAGG - Intronic
1142488262 17:260687-260709 TGTGTGTCAGGTAATGGAGGAGG - Intronic
1149014305 17:51890212-51890234 TGTGTTTCAGGTCATTCATGGGG + Intronic
1152265934 17:79294757-79294779 TGTGTGTCCCGTGAGGCATGGGG - Intronic
1153777563 18:8467066-8467088 TCTTTCTCACGTGTTGCATGGGG + Intergenic
1159048006 18:63388239-63388261 AGTCTCTCACATAATCCATGAGG + Intergenic
1166281732 19:41798535-41798557 TGAGTCTCAGGTAAAGGATGAGG - Intronic
927666772 2:25038315-25038337 TATGTCTCACCTACTGCCTGGGG + Intergenic
940501259 2:154496154-154496176 TGTATAGCACGTAATGCTTGAGG + Intergenic
943824332 2:192370036-192370058 TGTGTTTTACATAATGGATGTGG + Intergenic
945416601 2:209580755-209580777 TGTTTTTCATGTAAGGCATGAGG - Intronic
946045247 2:216815575-216815597 TATGTCTCAAATATTGCATGAGG + Intergenic
1173128946 20:40368929-40368951 TGTGTCCCAAATATTGCATGGGG - Intergenic
1178263456 21:31120873-31120895 TTCATCTCACGTAAAGCATGTGG - Intronic
1182162660 22:28138697-28138719 GGTCTCTCACGTACTGCCTGTGG - Intronic
1182481248 22:30610333-30610355 TGTGTAACACGTTCTGCATGTGG + Intronic
1185167567 22:49271022-49271044 TGTGGCTCTCGTTCTGCATGTGG + Intergenic
958155873 3:89755171-89755193 TATGTCTCAAATATTGCATGGGG - Intergenic
964635996 3:158859156-158859178 AGTGTCTCAGGTGATGGATGGGG + Intergenic
965545470 3:169911016-169911038 TGTGTTTCAAGTAATGCTTTAGG - Intergenic
968484720 4:853634-853656 TGTGTCTCACGCATTGCCCGGGG - Intronic
971927102 4:33025815-33025837 TGTGTCTCATGTAATACAAAGGG + Intergenic
973981323 4:56310474-56310496 TGTGTCTCAGGTAGTGCTGGTGG + Intronic
979029990 4:115631721-115631743 GGAGGCTCACGTAATGCATAAGG - Intergenic
983893253 4:173053575-173053597 TGTGTTTCACTTGATGAATGAGG + Intergenic
984140991 4:176003458-176003480 TCTTTCTCACGTAATGGAAGAGG + Intergenic
986547224 5:8911625-8911647 TGTGCCTCAGCTATTGCATGTGG - Intergenic
986571813 5:9173527-9173549 TGTGTCTCACATAGTGGAAGAGG + Intronic
988943974 5:36175793-36175815 TGTATTTCACGGAATGGATGAGG + Intronic
993256556 5:85598321-85598343 TTTGTCTCAAATATTGCATGGGG - Intergenic
995881669 5:116850682-116850704 TTTGTCTGAGGTAATACATGAGG + Intergenic
1003201217 6:3962708-3962730 TGTGTCGCAAATATTGCATGAGG + Intergenic
1003769786 6:9287070-9287092 TGTCTATCACTTAATGTATGTGG + Intergenic
1007157031 6:39755088-39755110 TGTGTCTTAACAAATGCATGTGG + Intergenic
1011868223 6:91859041-91859063 TGTGTCTTAAGTGATGCAAGTGG - Intergenic
1012195146 6:96332678-96332700 TGTGTCCCAAATATTGCATGGGG + Intergenic
1016885841 6:148958873-148958895 GGTGTCTCTCATAATGCATTTGG - Intronic
1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG + Intronic
1017431801 6:154378707-154378729 TGTCTCTCAGCTAATGCATGTGG - Intronic
1018765310 6:166928208-166928230 TGTGTCTCCTTTAATGCCTGCGG + Intronic
1020801201 7:12734221-12734243 TATGTCTCACATATTGTATGGGG + Intergenic
1023231238 7:38032144-38032166 TCTTTCTCAAGTATTGCATGTGG + Intergenic
1027955840 7:84878012-84878034 TGTGTATCACGCAATACATTGGG - Intergenic
1029378115 7:100194351-100194373 TGTGTCTCAAGGAATGAATAGGG + Intronic
1030130027 7:106191607-106191629 TGTGTTGCTCCTAATGCATGGGG + Intergenic
1031157785 7:118130536-118130558 TGTGTCCCAAATATTGCATGGGG + Intergenic
1036562554 8:9908875-9908897 TTTGTCTAACGTCATGCTTGTGG - Intergenic
1043526987 8:81107860-81107882 TGTGCCTCTCACAATGCATGAGG + Intronic
1051647568 9:19283893-19283915 TGTGTCTCAAGAAATGCATCTGG - Intronic
1052307425 9:27026086-27026108 AGTGACTCACCTAATGCATAAGG + Intronic
1056312780 9:85358352-85358374 TGTTTCTCAAGTGATGGATGGGG + Intergenic
1186183289 X:6993550-6993572 TGTGTGTCACATAATGTGTGTGG - Intergenic
1187283975 X:17885146-17885168 TGATTCTCATGTAATGAATGTGG + Intergenic
1193366499 X:80639971-80639993 AGAGTCTCACCTAATGCATAAGG + Intergenic
1193428415 X:81369738-81369760 TGTGTCCCAAATATTGCATGAGG - Intergenic
1195037029 X:100980064-100980086 TGAGTCTCACCTAAGGCCTGTGG + Intronic
1195310433 X:103627082-103627104 TGTGTCTCACAGAATGGAAGGGG + Intronic
1197380740 X:125736172-125736194 TGCGTCTCACCCAAGGCATGTGG + Intergenic
1199068300 X:143446267-143446289 TGTGTCCCAAATATTGCATGGGG + Intergenic
1200345358 X:155441803-155441825 GGTCCCTCCCGTAATGCATGGGG + Intergenic
1201674574 Y:16564986-16565008 TGTGTCTCATGAAGTGCATGGGG + Intergenic