ID: 1017126350

View in Genome Browser
Species Human (GRCh38)
Location 6:151067908-151067930
Sequence TGTGTCTCACGTAATGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017126347_1017126350 13 Left 1017126347 6:151067872-151067894 CCGATGTCATGGGGACACCAGCC No data
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126344_1017126350 19 Left 1017126344 6:151067866-151067888 CCCCTGCCGATGTCATGGGGACA 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126348_1017126350 -4 Left 1017126348 6:151067889-151067911 CCAGCCAAATGAACTCTGATGTG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126349_1017126350 -8 Left 1017126349 6:151067893-151067915 CCAAATGAACTCTGATGTGTCTC 0: 1
1: 0
2: 1
3: 13
4: 147
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126345_1017126350 18 Left 1017126345 6:151067867-151067889 CCCTGCCGATGTCATGGGGACAC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1017126346_1017126350 17 Left 1017126346 6:151067868-151067890 CCTGCCGATGTCATGGGGACACC No data
Right 1017126350 6:151067908-151067930 TGTGTCTCACGTAATGCATGTGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017126350 Original CRISPR TGTGTCTCACGTAATGCATG TGG Intronic