ID: 1017127581

View in Genome Browser
Species Human (GRCh38)
Location 6:151080275-151080297
Sequence GTGAACGATTTGAGGACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017127579_1017127581 -5 Left 1017127579 6:151080257-151080279 CCGAAAGAGAAGTGATTTGTGAA 0: 1
1: 0
2: 1
3: 35
4: 360
Right 1017127581 6:151080275-151080297 GTGAACGATTTGAGGACTTTTGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017127581 Original CRISPR GTGAACGATTTGAGGACTTT TGG Intronic
906249061 1:44297295-44297317 CTGAATGATTTGTGGACTCTGGG - Intronic
921393921 1:214648402-214648424 GTGAAAGATTTTAAGACTTAGGG + Intronic
1063849488 10:10168978-10169000 GTGAACAATGTGATAACTTTGGG + Intergenic
1063998787 10:11645497-11645519 GTGTACGTTTTGATGAGTTTGGG + Intergenic
1064858555 10:19798587-19798609 GTTAATGATGTGAGGACTCTTGG + Intergenic
1064937630 10:20696021-20696043 GTGTACAATTTGATGAGTTTTGG - Intergenic
1065724202 10:28654509-28654531 GTCAACTCATTGAGGACTTTGGG + Intergenic
1066787607 10:39022943-39022965 GTGAAACCTTTGAGGACTGTGGG - Intergenic
1074543019 10:114381499-114381521 GTGTACAATTTGATGGCTTTTGG - Intronic
1075883279 10:125873379-125873401 GTGAGGGATTAGAGGCCTTTGGG - Intronic
1077512275 11:2974284-2974306 GTGAATGATTGAAGGACTGTTGG - Intronic
1081125969 11:39321684-39321706 GAGAATCATTTGAGGACATTTGG - Intergenic
1082577270 11:54823319-54823341 GGGAGCGATTTGAGGCCTATGGG + Intergenic
1087205684 11:95391574-95391596 GTTAAGGCTTTGGGGACTTTGGG - Intergenic
1087253237 11:95927155-95927177 GGGAACTACTTCAGGACTTTAGG + Intergenic
1089451574 11:118601597-118601619 GTGAACTATTTGAGGGGTATGGG + Exonic
1095070052 12:37831012-37831034 GTGAGCGCTTTGAGGCCTATGGG + Intergenic
1101150521 12:101878543-101878565 GTTGACAAGTTGAGGACTTTGGG - Intronic
1101836183 12:108296995-108297017 GTGGAGGATTTAAGGAATTTGGG - Intronic
1108078191 13:46703550-46703572 GTGAACAATTTGGGGAATTTGGG + Intronic
1116290188 14:43024510-43024532 ATGTACGATGTGAGGACTATGGG + Intergenic
1117941998 14:60977860-60977882 GAAAACGTTTTGAGGAGTTTGGG + Intronic
1120433820 14:84454159-84454181 GTGGCCGATTTGAGAACTGTAGG - Intergenic
1121862206 14:97329126-97329148 GTGAAGAAATTGAGGGCTTTGGG + Intergenic
1123386873 15:19820387-19820409 GTGGACAATTGGAGCACTTTGGG - Intergenic
1124804243 15:32865221-32865243 GTGTACAATCTGATGACTTTTGG - Intronic
1125117297 15:36109648-36109670 GTGAATGTTTTTAGAACTTTAGG + Intergenic
1128264898 15:66257068-66257090 ATGAACGATTTCAGAACTTGTGG + Intergenic
1129502830 15:76056684-76056706 ATTAACAATTTAAGGACTTTGGG + Intronic
1132170319 15:99645062-99645084 AAGAAGAATTTGAGGACTTTGGG + Intronic
1137076468 16:35970443-35970465 GTGAACGAGTTGAGACCTATGGG - Intergenic
1138163839 16:54781200-54781222 TTGAAGGATTTGGGGACTTGGGG - Intergenic
1138229687 16:55327888-55327910 GTGAACGTTTTCAGTACCTTTGG - Exonic
1159333581 18:67033287-67033309 GTGAACTATTTGATGACTTGGGG - Intergenic
1159419724 18:68201851-68201873 GTGAAAGAGTTGAGGAGTTTGGG + Intergenic
1159786753 18:72723659-72723681 GTGATCTATTTAAAGACTTTGGG + Intergenic
1159808972 18:72993294-72993316 GTGAACGGTTTTAGGACTGGTGG + Intergenic
1164355372 19:27420424-27420446 GTGAGCCCTTTGAGGACTATGGG - Intergenic
1164355392 19:27420766-27420788 GTGAGCCCTTTGAGGACTATGGG - Intergenic
1164355412 19:27421108-27421130 GTGAGCCCTTTGAGGACTATGGG - Intergenic
938680838 2:133688434-133688456 GTGAATGATTTGAGGTTGTTTGG - Intergenic
939415281 2:141888134-141888156 GTGAACATTTTGACCACTTTAGG - Intronic
940735826 2:157451054-157451076 GTGAACTATTTTAGAACATTTGG - Intronic
943503675 2:188725127-188725149 GTGTACAATTTGATGAGTTTGGG - Intergenic
944901544 2:204221622-204221644 GTGATGGATTTGAGGAATCTAGG - Intergenic
946736915 2:222763212-222763234 GTGAAAAGTTTGATGACTTTGGG + Intergenic
948659500 2:239498402-239498424 GTAAACAATTGGAGGACTTCGGG + Intergenic
1171277291 20:23868650-23868672 GTGATAGATGTGAGGGCTTTTGG - Intergenic
1171809850 20:29737331-29737353 GTGAGCGCTTTGAGGCCTATGGG - Intergenic
1174157706 20:48527437-48527459 AGGAACGATTTGTGGACTCTTGG + Intergenic
1175049634 20:56142733-56142755 GTGAGCTATGTGGGGACTTTGGG + Intergenic
1175609839 20:60341596-60341618 GTGTACAATTTCAGCACTTTGGG + Intergenic
1180221531 21:46361998-46362020 GTGATAGATTTGGAGACTTTGGG + Intronic
1180510269 22:16077892-16077914 GTGGACATTTTGAGCACTTTGGG - Intergenic
952594979 3:35006374-35006396 GTGACCAATTTGAGGACATTAGG + Intergenic
952760175 3:36906524-36906546 GTGATCAATTTAAGGATTTTAGG + Intronic
953641261 3:44710614-44710636 TTCAACAATTTGAGGAATTTCGG + Intergenic
960080548 3:113535729-113535751 CTGTAAGATTTGAGGACATTTGG - Intronic
961406219 3:126681627-126681649 GTGGGGGATTTGGGGACTTTGGG + Intergenic
965545896 3:169915947-169915969 GTGTACAATTTGATGAGTTTTGG + Intronic
973202719 4:47522515-47522537 GTGAAGCATTTGTGGAATTTAGG + Intronic
975938750 4:79614564-79614586 GTTAACAATTTGAAGATTTTAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977806023 4:101298811-101298833 TTGAACAATTTGGGGACTTGGGG - Intronic
981897517 4:149820596-149820618 AAAAACGATTTCAGGACTTTGGG + Intergenic
982519877 4:156401991-156402013 GTGAAAGATTGGAGACCTTTAGG - Intergenic
984395724 4:179196700-179196722 GTGAGCGATTCGATGACTTCTGG + Intergenic
987061030 5:14244098-14244120 TGGAACGTTTTGAGGTCTTTGGG + Intronic
992825398 5:80544966-80544988 GAGAATGTTTTCAGGACTTTGGG + Intergenic
995396361 5:111691267-111691289 GTGTACCATTTGATGAGTTTGGG - Intronic
995736729 5:115309008-115309030 GTGAACAATGTGAGAACTTGTGG + Intergenic
996838896 5:127824522-127824544 GTGAAAGATTTGGGGAGTTTTGG - Intergenic
999372313 5:151063551-151063573 GTGAAGGATTTGGGCAGTTTGGG + Intronic
999970711 5:156859398-156859420 GTGAATCACTTGAGGACTTGAGG + Intergenic
1000352907 5:160366248-160366270 TTGAATTATTTGAGGTCTTTAGG + Intronic
1000389336 5:160706911-160706933 GTCAAAGATTTGTGGACTGTTGG + Intronic
1000959682 5:167585071-167585093 GTTAATGATTTGTGGTCTTTTGG - Intronic
1006791374 6:36703476-36703498 GTGAGAGAGTTGAGGAGTTTGGG + Intronic
1008054664 6:46933981-46934003 GTGAACAATTTGAGGAATTCCGG - Intronic
1008259645 6:49349409-49349431 TTCAAAGAGTTGAGGACTTTAGG + Intergenic
1017127581 6:151080275-151080297 GTGAACGATTTGAGGACTTTTGG + Intronic
1020634564 7:10680948-10680970 GTCAAGGGTTTGAGGGCTTTGGG - Intergenic
1022060777 7:26792298-26792320 GTGAACAATGTGATGAGTTTTGG - Intronic
1022763558 7:33383684-33383706 GTGAACAATTTGAAGATCTTTGG + Exonic
1025036173 7:55593775-55593797 GTGAATGAGTTTAGGACTTGGGG - Intergenic
1025314551 7:58003092-58003114 GGGAACGATTTGAGCACCATGGG + Intergenic
1025492857 7:61154425-61154447 GTGGGCATTTTGAGGACTTTGGG + Intergenic
1025514004 7:61608479-61608501 GTGGGCATTTTGAGGACTTTGGG + Intergenic
1025572262 7:62589377-62589399 GTGAGCAATTTGAGGCCTATGGG - Intergenic
1028911227 7:96209613-96209635 TTGAACAATTTGAGAACTCTTGG - Intronic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1040135844 8:43852749-43852771 GGGAACCCTTTGAGGACTATTGG + Intergenic
1041057793 8:54005613-54005635 GTGAAGGAGTGGAGGAATTTAGG - Intronic
1041282284 8:56222970-56222992 GTGAATGATTTGGGGACCCTTGG + Intergenic
1042502335 8:69523253-69523275 GTGAACAAGTTGAGGAGTTGGGG + Intronic
1050226602 9:3464713-3464735 GTGTACAATTTGATGAGTTTTGG - Intronic
1052763532 9:32617327-32617349 TTGAACTATTCGAGGATTTTTGG - Intergenic
1053711674 9:40817385-40817407 GTGGACATTTGGAGGACTTTTGG + Intergenic
1054422137 9:64949263-64949285 GTGGACATTTGGAGGACTTTTGG + Intergenic
1054992874 9:71350592-71350614 GTGAAATATCTGAGGATTTTAGG - Intronic
1057439890 9:95075298-95075320 GTGTACCATTTGATTACTTTTGG + Intronic
1059781975 9:117539230-117539252 GTTTACAATTTCAGGACTTTGGG - Intergenic
1060774055 9:126356486-126356508 GTGTATGATTTGATGAGTTTTGG + Intronic
1203383720 Un_KI270435v1:91366-91388 GTGAGCGCTTTGAGGCCTATGGG - Intergenic
1203360029 Un_KI270442v1:211711-211733 GTGAGCGCTTTGAGGCCTTTGGG - Intergenic
1187309275 X:18125565-18125587 GTGAAGGGTTGGAGGACATTGGG - Intergenic
1187362275 X:18640106-18640128 GTGTACAATTTGATGACTTTTGG - Exonic
1191294825 X:58849969-58849991 GTGGACGTTTGGAGGGCTTTGGG + Intergenic
1191317697 X:59155044-59155066 GTGGACGTTTGGAGGGCTTTGGG + Intergenic
1191437596 X:60759602-60759624 GTGGACGTTTGGAGGGCTTTGGG + Intergenic
1191526312 X:61946583-61946605 GTGTACGTTTGGAGGGCTTTGGG + Intergenic
1191574675 X:62686256-62686278 GTGAGCGCTTTGAGGCCTATGGG + Intergenic
1195559564 X:106268175-106268197 GTCAACGGCTTTAGGACTTTAGG + Intergenic
1195562397 X:106298164-106298186 GTCAACGGCTTTAGGACTTTAGG - Intergenic
1196690471 X:118553606-118553628 GTTAAGGATTTAAGGACTTTTGG - Intronic
1199198042 X:145055606-145055628 GTGCACAATTTGATGAGTTTTGG - Intergenic