ID: 1017127790

View in Genome Browser
Species Human (GRCh38)
Location 6:151081749-151081771
Sequence GGGCAAGGGTCTAGTTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017127787_1017127790 -10 Left 1017127787 6:151081736-151081758 CCCAGGGTCGGAGGGGCAAGGGT 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1017127790 6:151081749-151081771 GGGCAAGGGTCTAGTTGTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017127790 Original CRISPR GGGCAAGGGTCTAGTTGTGA GGG Intronic
900309595 1:2027281-2027303 GGGCCAGGGCCTGGGTGTGAAGG + Intronic
902623309 1:17662832-17662854 GGGGAAGGGTCTGCCTGTGATGG + Intronic
904626249 1:31805537-31805559 GGGCCAGGGTCTGGCTGTGTTGG - Intronic
904691541 1:32296825-32296847 AGGAAAGGGACTAGTAGTGATGG + Intronic
905857286 1:41322384-41322406 GGGCCTGGGTCTGGGTGTGATGG + Intergenic
905892850 1:41528061-41528083 GGGCAAGGGTATGAGTGTGAAGG - Intronic
908088592 1:60662762-60662784 TGGCAAGGGCCAAGTTGTCATGG - Intergenic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
908643413 1:66250249-66250271 GACCAAGAGTCTAGATGTGAAGG + Intronic
909598392 1:77432888-77432910 GGGCAAGAGTCTCATTTTGATGG + Intronic
912553642 1:110500455-110500477 GGAGGAGTGTCTAGTTGTGATGG - Intergenic
913478020 1:119258015-119258037 GGACAAAGGTGAAGTTGTGAAGG + Intergenic
918107408 1:181426456-181426478 GGGAAGGGGTTGAGTTGTGATGG - Intronic
918107459 1:181426680-181426702 GGGAAGGGGTTGAGTTGTGAAGG - Intronic
918107507 1:181426888-181426910 GGGAAGGGGTTGAGTTGTGAAGG - Intronic
918107520 1:181426951-181426973 GGGAAGGGGTTGAGTTGTGAAGG - Intronic
918702258 1:187620039-187620061 GGGGCAGGGTCTATTTGAGAAGG + Intergenic
1064450944 10:15441748-15441770 GGGCAATGGACCACTTGTGATGG - Intergenic
1072808586 10:98442963-98442985 GGATAAGGGTCTAGGTGTGAAGG + Intronic
1073915746 10:108401251-108401273 AGGCAAGGGTCAAATTGTGGAGG - Intergenic
1075679201 10:124320540-124320562 AGGCAAGGGGCTAGGGGTGAAGG + Intergenic
1077095058 11:795726-795748 GGGCAAGGGGCTGGCTGTGGGGG - Intronic
1080572394 11:33568107-33568129 GGGCAAAGCTCTGGTTGTGCAGG - Exonic
1083763746 11:64832559-64832581 GGGCAAGGGACTAGTGGTAAGGG - Intronic
1084982638 11:72839250-72839272 AGGCTAGGGTTAAGTTGTGAAGG + Intronic
1085169321 11:74435045-74435067 CTGCAGGGGTCTAGGTGTGAGGG + Intergenic
1089998854 11:122935531-122935553 GGCCAAGAGTCTACTTTTGATGG + Intronic
1091554572 12:1562954-1562976 GGGCAGGGGACTAGGTGTGTGGG - Intronic
1091569356 12:1670962-1670984 GGGCAAGGGCCTGGTGGTGATGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1097219533 12:57439747-57439769 GTGCATTTGTCTAGTTGTGAGGG + Intronic
1099967214 12:89461406-89461428 TGTCAAGGGTCAAATTGTGAAGG + Intronic
1103052201 12:117790026-117790048 TGGCAGGGGTCCAGGTGTGACGG - Intronic
1103174753 12:118853177-118853199 GGGCTAGAGTCTAGTTGGGATGG + Intergenic
1103336176 12:120191763-120191785 GGGCAAGGGACTGGTTTTTATGG - Intronic
1103871253 12:124093854-124093876 GGCCCAGGGTCAAGTTGTGTGGG + Intronic
1109108748 13:58289541-58289563 TGGCAAGGGGCTAGTTGCCAAGG - Intergenic
1112006039 13:95254561-95254583 GGGCAAGGGGAAAGATGTGACGG - Intronic
1114314887 14:21500619-21500641 GGGCAAGTTTGCAGTTGTGATGG - Exonic
1118724418 14:68618741-68618763 GGGCTAGGCTCAAGTTGTCAGGG - Intronic
1119977612 14:79042726-79042748 TGGCAAGTGTGTATTTGTGATGG + Intronic
1121379570 14:93451406-93451428 GGGTAAGGGTCTAGCTGCCAGGG + Intronic
1122862607 14:104589268-104589290 AGGGAAGGGTCTGGTTGTCAAGG + Exonic
1123405900 15:20019269-20019291 GGGCCAAGGTCTAGGTGTGCTGG + Intergenic
1123515230 15:21025917-21025939 GGGCCAAGGTCTAGGTGTGCTGG + Intergenic
1123971231 15:25509749-25509771 GGGCCAGGGTGTAGTCGTCAAGG + Intergenic
1127329178 15:57922206-57922228 GGGCTAGGGGTTAGTTGCGAGGG - Intergenic
1131197221 15:90365255-90365277 GGGCAAGGATCTCATTGTGCTGG + Intronic
1134049458 16:11126846-11126868 GGGGAGGGGTTAAGTTGTGAGGG - Intronic
1137587297 16:49671258-49671280 GGGTAAGGGACGAGGTGTGAAGG + Intronic
1138250684 16:55499545-55499567 AGGAAAGGGTCCAGTTCTGAGGG + Intronic
1143784309 17:9245275-9245297 GGTCAAGGGTCCAGTTCTTAAGG + Intergenic
1144529413 17:16021613-16021635 GGCCAAGTGGCTATTTGTGAGGG + Intronic
1151824802 17:76518260-76518282 GGGCAAGGGTCTCTCTGAGAGGG - Intergenic
1162300436 19:9841973-9841995 GGGCATGGGTCTGGGTGTGGTGG + Intronic
1162550791 19:11357228-11357250 GGGGAAGGGTCTGGTAGGGATGG + Intronic
1165824057 19:38695550-38695572 GGACAAGGGTCAATGTGTGATGG - Intronic
928206463 2:29288116-29288138 GGGGAAGGCTATAGCTGTGAAGG - Intronic
929578181 2:43065885-43065907 GGGAAAAGGTCCAGGTGTGAAGG + Intergenic
933782198 2:85810678-85810700 GGGCAAGTGGCCAGGTGTGAAGG - Intergenic
937095252 2:119231099-119231121 GGGCAGGGGTCAGGTGGTGAGGG - Intronic
946008157 2:216543000-216543022 GGGCAAGCCTAGAGTTGTGATGG - Intronic
947267904 2:228302978-228303000 GGGCTAAGATCTAGTTCTGAAGG + Intergenic
947575456 2:231270136-231270158 GGGCAAAGGTCTGGTTGCCAGGG + Intronic
1174518447 20:51111563-51111585 GGAGAAGGTTCTGGTTGTGATGG - Intergenic
1181040634 22:20190940-20190962 AGGCAGGGGTCTAGTTGAGCTGG + Intergenic
1182131843 22:27859743-27859765 GGGGAAGGGTCCAGCTGAGATGG + Intronic
1183153427 22:36055510-36055532 GGGTAAGGGTTTGGTTGTCAGGG + Intergenic
949420917 3:3864850-3864872 GGACAGGGGTCAAATTGTGAAGG - Intronic
949752980 3:7375716-7375738 GGGCAAGGGTGTAGTTTTGCAGG - Intronic
949907731 3:8872733-8872755 AGGCAAGGGAATGGTTGTGAGGG + Intronic
954689683 3:52388974-52388996 GGGGAAGGGTCTCTTTGGGAAGG - Intronic
960110735 3:113842137-113842159 AGGCAAAGGTATAGTTCTGATGG + Intronic
960696661 3:120402938-120402960 GGGCAACAGTTTAGCTGTGAGGG + Intronic
961201026 3:125045500-125045522 GGTCAAGGGTAGAGCTGTGAAGG + Intronic
962199975 3:133393015-133393037 GGGCAGGGGCCAACTTGTGAAGG - Intronic
962313269 3:134340870-134340892 GGGCAAGTGTTTATCTGTGAGGG + Intergenic
966141159 3:176757870-176757892 AGGCAAGGGTATAGTTATGTAGG - Intergenic
968599624 4:1502885-1502907 GGGAAACGGCATAGTTGTGATGG - Intergenic
976378638 4:84374352-84374374 GGCAAAGGGTCTAGATGTTATGG + Intergenic
977243777 4:94604960-94604982 GGGTTGGGGTCTAGTTGAGATGG + Intronic
986814821 5:11397105-11397127 GGGCCAGGGTCTGGTTGCTATGG + Exonic
988846292 5:35131404-35131426 GGGAGAGGGTCTAGTGGTGGCGG + Intronic
996115223 5:119610544-119610566 TGGAAAGTTTCTAGTTGTGAGGG + Intronic
1005035001 6:21547413-21547435 GGGCAAGGAACTAGTCATGAAGG + Intergenic
1006795293 6:36728552-36728574 GGGAAAGGGTCCAGGTGAGAAGG + Intronic
1006909906 6:37557163-37557185 GGGCAAGGGCCTAGGTCAGAGGG - Intergenic
1007240098 6:40418595-40418617 AAGCCAGGGTCTAGTTCTGAGGG - Intronic
1007285803 6:40746659-40746681 GGGCAGGGGTCTTGTTGGGGAGG - Intergenic
1017127790 6:151081749-151081771 GGGCAAGGGTCTAGTTGTGAGGG + Intronic
1024567548 7:50694400-50694422 GGGCTAGGGTCGATTTGTGACGG + Intronic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1028652956 7:93170892-93170914 GGGCATGGGTGTGGTGGTGATGG + Intergenic
1029433342 7:100546724-100546746 GGGGAAGGGCCTAGTGGTTAAGG + Intronic
1030289144 7:107855168-107855190 AGGAAAGGGTCTAGTGGAGAGGG - Intergenic
1031861445 7:126984258-126984280 TGGCAAGGGTGGACTTGTGATGG + Intronic
1037523575 8:19703179-19703201 TGCCATGGGTCTAGTTGAGAAGG - Intronic
1040740261 8:50565694-50565716 AGCCAAGAGTCTAGTTGGGAAGG + Intronic
1041262433 8:56033479-56033501 GGGCAAGGGCATAGTTGGAAAGG - Intergenic
1043235462 8:77859946-77859968 CTTCAAGGGTCTAGTAGTGATGG + Intergenic
1047197881 8:122737974-122737996 GTGCCAGGTTCTTGTTGTGAAGG - Intergenic
1048177405 8:132165058-132165080 TGGAAAGGGTCTAGTAGAGAAGG - Intronic
1049479621 8:142815677-142815699 GGGCAAGGTTCTGGGTGGGAAGG - Intergenic
1051330423 9:16019507-16019529 GGGCAAGAGTTGAGCTGTGAGGG + Intronic
1059478001 9:114563596-114563618 GGGCAAGAGTCTCATTATGACGG + Intergenic
1062270866 9:135707717-135707739 GGGCACGGGTCCAGGGGTGATGG + Intronic
1186553731 X:10534902-10534924 AGGCAAGGGTCTGTTTTTGAAGG - Intronic
1199037127 X:143064327-143064349 GGGCCAGGGCCTAGTCCTGAAGG + Intergenic
1199260750 X:145771673-145771695 GAGAAAGGGTCAAGTTGTAAAGG - Intergenic