ID: 1017128019

View in Genome Browser
Species Human (GRCh38)
Location 6:151084082-151084104
Sequence ATGTAGCTATAGATGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017128019_1017128024 29 Left 1017128019 6:151084082-151084104 CCTGGCTACATCTATAGCTACAT 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1017128024 6:151084134-151084156 GTGTCACTGTTGGAGTTGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 118
1017128019_1017128021 19 Left 1017128019 6:151084082-151084104 CCTGGCTACATCTATAGCTACAT 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1017128021 6:151084124-151084146 TCCCTCAGAAGTGTCACTGTTGG No data
1017128019_1017128025 30 Left 1017128019 6:151084082-151084104 CCTGGCTACATCTATAGCTACAT 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1017128025 6:151084135-151084157 TGTCACTGTTGGAGTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017128019 Original CRISPR ATGTAGCTATAGATGTAGCC AGG (reversed) Intronic
901304039 1:8219494-8219516 ATGTATCTATAGATATAGATGGG + Intergenic
902335849 1:15754109-15754131 ATGTGGCTCTAGCTGTGGCCTGG + Intergenic
905914596 1:41675982-41676004 ATGTGGCATTAGATGTTGCCCGG - Intronic
906305220 1:44713973-44713995 ATGTAGTTAGAGAGGTAGCAGGG + Intronic
906845671 1:49189068-49189090 GGGTAGCTATGCATGTAGCCAGG + Intronic
908007639 1:59743087-59743109 ATGAAGCTATAGATGAAGGCAGG - Intronic
911331229 1:96528043-96528065 ATGTAGATTTTAATGTAGCCTGG - Intergenic
912870582 1:113301206-113301228 TTTTAACTATAGGTGTAGCCTGG - Intergenic
916523109 1:165582451-165582473 TTGTAGCTACAGCTGGAGCCTGG - Intergenic
919108423 1:193185818-193185840 ATGCAGCTAAATATGTAGCTTGG - Intronic
919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG + Intergenic
921595128 1:217046482-217046504 ATGAAGCTATAAATGTAGGTAGG - Intronic
921889012 1:220335155-220335177 ATCTAAATATATATGTAGCCAGG - Intergenic
924865426 1:247974364-247974386 ATGTAGGTATACATGTACCATGG - Intronic
1066466606 10:35656228-35656250 ATGTAGCTATATTTGTTCCCAGG + Intergenic
1071013862 10:80971424-80971446 ATGAAGCCATAGTTGTAGGCTGG + Intergenic
1071734113 10:88279242-88279264 AGGTAGCTTTAGATCTAGCTAGG - Intronic
1072446502 10:95503410-95503432 ATGTAGAGATGGATATAGCCAGG - Intronic
1073068765 10:100780358-100780380 CTGTAGCCATAGATGAGGCCCGG + Intronic
1073258593 10:102171773-102171795 ATGAAGCTAGAGAGGTAGGCAGG + Intergenic
1078429627 11:11278983-11279005 ATGTACCCATTGATGTAGTCTGG + Intronic
1081359418 11:42156075-42156097 ATGTAGTTATAGATCTATCTTGG + Intergenic
1086187441 11:84035581-84035603 ATGAAGCCAAAGAGGTAGCCAGG + Intronic
1087071566 11:94086593-94086615 ATGTAGCCATAACTGCAGCCTGG + Intronic
1089882971 11:121792519-121792541 AAGGGGCTATAGGTGTAGCCAGG + Intergenic
1092175275 12:6400466-6400488 ATGAAGCTAGAGAAGTAGGCGGG + Intergenic
1093218550 12:16391204-16391226 ATGTAGGTATACATGTACCACGG + Intronic
1097870569 12:64598469-64598491 ATGTAGCTATAGCTATGGCATGG + Intergenic
1101320004 12:103665270-103665292 AGGCAGCTATAGATTCAGCCTGG - Intronic
1101508941 12:105375438-105375460 ATGTCGGGGTAGATGTAGCCAGG + Intronic
1101643521 12:106606404-106606426 ATGTAGCTATGGCTGCTGCCAGG + Intronic
1104496499 12:129245308-129245330 GTGTAGCTATAGCTTTAGACTGG + Intronic
1108824798 13:54399649-54399671 ATATTGCTATAGATGTATGCTGG + Intergenic
1110210752 13:72969535-72969557 ATGTTGCTATAGGTGTACCCTGG + Intronic
1112665289 13:101564570-101564592 ATGTACATATATATGTATCCTGG + Intronic
1113303986 13:109056514-109056536 ATGTACCTAAAGATGAGGCCTGG - Intronic
1114789730 14:25643706-25643728 ATTTAGATTTAGATGGAGCCTGG - Intergenic
1116678036 14:47930639-47930661 ATGTAGGTATATATGAAGCCAGG - Intergenic
1119015769 14:71052684-71052706 ATTTAGCTTTAGAAATAGCCAGG - Intronic
1119968171 14:78940092-78940114 ATGAGTCTAAAGATGTAGCCAGG - Intronic
1202829218 14_GL000009v2_random:8170-8192 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1202900930 14_GL000194v1_random:38022-38044 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1129017152 15:72478434-72478456 ATGTAACTATATAAGTAGCTAGG + Intronic
1129610797 15:77054432-77054454 ATATAGATATAGATGAAGGCAGG + Intronic
1129981247 15:79873166-79873188 ATATATCTATAGCTGGAGCCTGG - Intronic
1133618400 16:7501871-7501893 CTGTAGCTATAGAGGTACCTGGG + Intronic
1134323241 16:13183022-13183044 ACGTGGCTATTCATGTAGCCTGG + Intronic
1138890180 16:61132301-61132323 ATGTAGCTATATATCTAGCTAGG - Intergenic
1141194101 16:81846700-81846722 TTGAATCTATAGATGAAGCCAGG - Intronic
1143716935 17:8779900-8779922 CTGAAGCTTTAGATGTAGCCTGG + Intergenic
1145201961 17:20953677-20953699 ATGTAACTAAAGAAGGAGCCAGG + Intergenic
1150236290 17:63595456-63595478 ATGTAGCTAGAGATGTATACAGG + Intergenic
1152883085 17:82831551-82831573 ATGTGGCTGGAGATGGAGCCAGG + Exonic
1153279338 18:3399374-3399396 ATGCAGCTATAGATATAGATAGG - Intergenic
1155816882 18:30323362-30323384 AAGTAGCTACAGATGCAGCTAGG - Intergenic
1158364910 18:56723329-56723351 GTGTAGATATAGATTTTGCCTGG + Intronic
1202643478 1_KI270706v1_random:119619-119641 ATGCAGAGATAGATGTGGCCTGG - Intergenic
925957620 2:8983137-8983159 ATCAAGCTCTAGATGCAGCCAGG - Intronic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
926582044 2:14641513-14641535 AGGAAGCTATAGAAATAGCCAGG - Intronic
927734223 2:25503965-25503987 ATGTAGAAATAAATTTAGCCTGG + Intronic
934106106 2:88695978-88696000 TTCTAGTTATAGATGTAGTCAGG + Intronic
934505860 2:94893078-94893100 ATGTAGAGATAGATGTGGCCTGG - Intergenic
940544735 2:155069598-155069620 ATGAAGCTAAAGTTGTAGGCTGG + Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
942833337 2:180263234-180263256 ATCTATCTCTAGATGAAGCCAGG + Intergenic
948042858 2:234917601-234917623 ATGAATCTACAGCTGTAGCCAGG + Intergenic
1169676587 20:8161269-8161291 ATGTATGTATATATGTAGCACGG - Intronic
1173759068 20:45543860-45543882 ATGGAGGTATAGAGGTAGCACGG - Intronic
1173941266 20:46913362-46913384 ATGTAGTTAGGGAAGTAGCCAGG + Intronic
1176608402 21:8853010-8853032 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1176620304 21:9052800-9052822 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1180358485 22:11862814-11862836 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1180379777 22:12129516-12129538 ATGCAGAGATAGATGTGGCCTGG - Intergenic
951189468 3:19751535-19751557 ATGTAACTACTGATGTAGCATGG + Intergenic
951382283 3:21998207-21998229 GGGTAGGTATAAATGTAGCCAGG + Intronic
951927746 3:27927091-27927113 ATGTAGCTACAGATCTAACTGGG + Intergenic
957179426 3:76857847-76857869 ATAAAGCTAAAGAGGTAGCCTGG - Intronic
959232805 3:103678246-103678268 ATATGGATATAAATGTAGCCTGG - Intergenic
961691474 3:128673184-128673206 ATATAGATATATATGTAGCTGGG - Intronic
962015811 3:131439446-131439468 AGGTAGGTATAGATGCAGCTGGG - Intergenic
964223307 3:154369839-154369861 AAGCAGCTTTAGCTGTAGCCCGG + Intronic
967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG + Intergenic
968321453 3:197772465-197772487 ATGTAGCTATACATGTGCCATGG - Intronic
969144985 4:5114777-5114799 ATGTAGCTATTCAGGAAGCCAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970455983 4:16224942-16224964 AAATAGAGATAGATGTAGCCAGG - Intronic
972157847 4:36186638-36186660 TGGTGGCTATAGATGCAGCCAGG - Intronic
972261951 4:37417699-37417721 ATACAGCTATACATGTATCCTGG + Intronic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
977069671 4:92368884-92368906 ATGTAGCTACAGATTTATGCTGG + Intronic
977483683 4:97613953-97613975 TTGTAGCTGTAGATGAAGCTAGG - Intronic
979342979 4:119550063-119550085 ATGTACCTACAGTTGTAGCATGG - Intronic
982454042 4:155586503-155586525 AAGGAGCTAGAGATATAGCCAGG - Intergenic
983423126 4:167546535-167546557 ATGTAGCTATACATGTGCCATGG + Intergenic
983661783 4:170136368-170136390 CTGCAGCCATAGATTTAGCCAGG + Intergenic
983971075 4:173874989-173875011 ATGTGGCTATAGAGATTGCCAGG + Intergenic
1202770848 4_GL000008v2_random:205533-205555 ATGCAGAGATAGATGTGGCCTGG - Intergenic
994679456 5:102867020-102867042 ATGGAGTTTTAAATGTAGCCTGG + Intronic
995280894 5:110334431-110334453 CTGTAGGTAGAGAAGTAGCCTGG - Intronic
1000513766 5:162215278-162215300 ATATTGATATAGATGTAGGCAGG - Intergenic
1009638226 6:66295160-66295182 ATGTAGCCATATATGTACCCGGG + Intergenic
1010301828 6:74269646-74269668 ATTTAGCTGCAGCTGTAGCCTGG - Intergenic
1014304217 6:119720281-119720303 ATTTTGCTATAGCTGTGGCCTGG - Intergenic
1017128019 6:151084082-151084104 ATGTAGCTATAGATGTAGCCAGG - Intronic
1024311592 7:47974553-47974575 ATGTGGCTATAAAGGTGGCCTGG + Intronic
1026405260 7:70058595-70058617 ATGTAGCAATAGATAAATCCAGG - Intronic
1030872419 7:114773555-114773577 TTGTGGCTATTGATGTAGCCAGG - Intergenic
1036987495 8:13552250-13552272 ATATAGGTATATATGTAGACAGG - Intergenic
1043849320 8:85198116-85198138 ATGTACCTATATCTGTACCCAGG + Intronic
1045464836 8:102460348-102460370 ATATATATATATATGTAGCCAGG + Intergenic
1046592009 8:116218248-116218270 ATGAAGCCATGGATGTAGGCAGG + Intergenic
1049696000 8:143984644-143984666 ATGGTGCTATTGATGGAGCCAGG - Exonic
1051189865 9:14500052-14500074 ATGTGGCTAAAGAGGTAGGCAGG - Intergenic
1051195487 9:14559232-14559254 AGGTAGCTATAGATGTATTTAGG + Intergenic
1051624041 9:19081182-19081204 ATGTAGCAAAAAATGTAGCAAGG - Intronic
1051712460 9:19945911-19945933 CTGTAGCTTTAGAAGTAGACTGG + Intergenic
1053062692 9:35044234-35044256 ATGTAGCTTCTGATGTAGCGAGG - Exonic
1054355191 9:64054154-64054176 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1055993433 9:82131605-82131627 TTGTAGCCATAGCTGGAGCCTGG - Intergenic
1056241128 9:84647590-84647612 ATGCAGCCATAGATGCAGGCAGG + Intergenic
1059415415 9:114159299-114159321 ATTTTGGTATAGCTGTAGCCAGG + Intronic
1060923138 9:127436753-127436775 ATGTTTCTAAAGATGCAGCCTGG + Intronic
1203703801 Un_KI270742v1:18220-18242 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1203566594 Un_KI270744v1:96260-96282 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1187375317 X:18747384-18747406 ATGCAGCTATGGATGCAGACAGG - Intronic
1188111747 X:26202266-26202288 ACCTAGCTATACATCTAGCCAGG + Intergenic
1190470993 X:50779582-50779604 ATGTAGCTGGGGATGTAGACAGG - Intronic
1190541423 X:51482025-51482047 ATGTGGCTTTAGCTGCAGCCTGG + Intergenic
1195384761 X:104303542-104303564 ATGAGGCTAAAGATGTAGGCAGG - Intergenic
1196205771 X:112937711-112937733 ATGTATATATATATTTAGCCGGG + Intergenic
1197168478 X:123405536-123405558 ATGAAGCTAGAGAGGTAGGCGGG - Intronic
1197667401 X:129238604-129238626 AGGAAACTATAGATGTAGCCAGG - Intergenic
1198325139 X:135563665-135563687 ATATAGCTATATATATAGCTAGG + Intronic
1201343833 Y:12961038-12961060 ATGGATATATAGATGTAACCAGG + Intergenic