ID: 1017129458

View in Genome Browser
Species Human (GRCh38)
Location 6:151095531-151095553
Sequence CTAAGGATGTATCCCTGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017129458 Original CRISPR CTAAGGATGTATCCCTGAGT AGG (reversed) Intronic
903273930 1:22208974-22208996 CAAAGGATGGGGCCCTGAGTCGG + Intergenic
904555153 1:31357269-31357291 CAGAGAATGTGTCCCTGAGTGGG - Intronic
905243257 1:36595155-36595177 CCAAGGATGTGGCCCTGAGCCGG - Intergenic
906005090 1:42462325-42462347 CAAGGAATGTCTCCCTGAGTAGG + Intronic
911023243 1:93409328-93409350 CTAATGGTGAATCCTTGAGTTGG - Intergenic
913196135 1:116457686-116457708 TTGAGGATCTATCTCTGAGTTGG + Intergenic
914253696 1:145943401-145943423 CAAAGGAGCTATCCCTGAGAAGG + Intronic
921353687 1:214264049-214264071 CATGGGATGTATCCCTGAGGTGG - Intergenic
1073152133 10:101319307-101319329 CTAGGGATATATCCAGGAGTTGG - Intergenic
1074970873 10:118536224-118536246 CTCAGGAAGTATCCATCAGTAGG - Intergenic
1075926080 10:126252728-126252750 GTATGGATGTATCCATGAGGAGG - Intronic
1077981199 11:7302453-7302475 CTGAGGACTTATCACTGAGTGGG + Intronic
1081367166 11:42249428-42249450 CTAAAGATGTTTTCCTGAGAGGG + Intergenic
1083722935 11:64612314-64612336 CTAAGGATGCATCCTGGAATGGG + Intronic
1090248167 11:125231940-125231962 CAAAGCATGTTTCCCTGATTTGG - Intronic
1095736895 12:45567480-45567502 TGAGGGATGTATACCTGAGTTGG + Intergenic
1098654649 12:73013040-73013062 TAAAGGAAGTATCCCTGGGTAGG + Intergenic
1102243933 12:111343132-111343154 CTCAGGGTGGATCCCTGATTTGG + Intronic
1102546846 12:113663493-113663515 CTGAGGAGGTGTCCCTGAGCTGG - Intergenic
1113282332 13:108802578-108802600 CTTAGGATATATACCAGAGTGGG + Intronic
1114218070 14:20672568-20672590 CTGAGAATGTGTCCCAGAGTGGG - Intergenic
1115435759 14:33371197-33371219 CTAAGGATAAATCCTTTAGTAGG + Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1125347196 15:38730307-38730329 CTAAGGAACTAGCCCTGGGTGGG - Intergenic
1131648598 15:94374534-94374556 CTAAGGAAGAATCACTGATTTGG - Intronic
1133400524 16:5483076-5483098 TTAAGTCTGTAGCCCTGAGTAGG + Intergenic
1139115345 16:63944469-63944491 CTAAGTATTTATCCATGAATAGG - Intergenic
1141792377 16:86245470-86245492 CTAAGGCTGTGGCCCTCAGTCGG - Intergenic
1146240339 17:31216935-31216957 CTAAGGAAGCCTCCCTGAGTCGG + Intronic
1148411178 17:47468560-47468582 CTAATTATGTCTCACTGAGTGGG - Intergenic
1153939769 18:9967945-9967967 CTCAGGAAGTACCCCTGATTTGG - Intergenic
1155047596 18:22116552-22116574 CTAAGAATGTATCCTTGACCTGG - Intergenic
1155179720 18:23333971-23333993 CTGGGGATGTAACCCTGAGTAGG + Intronic
1155400122 18:25429028-25429050 CTAGGGATGAATCTCTGTGTGGG + Intergenic
1157520362 18:48341311-48341333 CTGAGGATGTAGCCCTGGCTCGG + Intronic
1157905388 18:51564852-51564874 CTTAGGATGGATCTCTGAGTTGG + Intergenic
1157991632 18:52503847-52503869 CTAACACTGTTTCCCTGAGTAGG - Intronic
1160336638 18:78047327-78047349 CTAATGACAAATCCCTGAGTTGG - Intergenic
1165334245 19:35157857-35157879 CTCAGGTCGTATCCCTGAGCTGG + Intronic
1167600686 19:50453051-50453073 CTGAGGATGCAACCATGAGTTGG + Intronic
1167640712 19:50679694-50679716 CTAAGGAGGCAGCCCTGAGAGGG + Intronic
933779907 2:85794491-85794513 CAAAGGCTGAAGCCCTGAGTGGG + Intergenic
936718739 2:115222612-115222634 ATAAGGATATATCCCAGACTGGG - Intronic
940201533 2:151156701-151156723 CTATGGTTGTATCCCATAGTTGG - Intergenic
944187426 2:196964555-196964577 CAAAGGCTGTACCCCTGATTGGG - Intergenic
946099369 2:217306039-217306061 CCAAGGATGCATCATTGAGTTGG - Intronic
947148516 2:227090301-227090323 CTAAGAATTGATCACTGAGTGGG - Intronic
1183560765 22:38570587-38570609 CTGAGGAGGTAGCCTTGAGTCGG + Intergenic
1184218555 22:43083802-43083824 ATTAGGATTTATTCCTGAGTTGG + Intronic
1184534956 22:45080208-45080230 CTGAGGATGTCTCCATGAGATGG - Intergenic
949553115 3:5129057-5129079 CTGAGGATGTGTTCCAGAGTTGG + Intronic
950675982 3:14554674-14554696 CTAAGGAAGACTCCCTGTGTAGG + Intergenic
951772450 3:26273739-26273761 CCAAGAATGTGTCCCTGAGTGGG + Intergenic
951773130 3:26280821-26280843 CTGAGAATGTATCCCTGAGTAGG + Intergenic
951851694 3:27148367-27148389 CTAAGAATCTATCCATGTGTTGG - Intronic
952612191 3:35225401-35225423 CTAAGGAAGCATCCCTGAAATGG - Intergenic
952804528 3:37335574-37335596 CTAAGGATGTATTATAGAGTAGG - Intronic
954886503 3:53879887-53879909 CTAAGGTTGTTTCCCTGGGAGGG - Intronic
955540348 3:59969684-59969706 CTAAGGATATTTCCCTCAATGGG + Intronic
956004210 3:64761717-64761739 CTGAGGAGGTATCCCAGAGGAGG + Intergenic
964320312 3:155488789-155488811 CTGAGGATTTAACCCTGTGTGGG - Exonic
968669621 4:1842083-1842105 CAAAGGCTGGATCCCTGGGTGGG + Intronic
969574948 4:8031256-8031278 CTCAGGCTGTACCCCAGAGTGGG - Intronic
971782591 4:31056047-31056069 CTAAGAATGTATCCCAGAAGTGG + Intronic
973808818 4:54550519-54550541 CTGAGGGTGTGTCCCTGAGGGGG - Intergenic
985483035 5:129542-129564 CTGAGAATGTGTGCCTGAGTTGG - Intergenic
985642198 5:1068953-1068975 CTTAGGAGGAATCCCGGAGTTGG - Intronic
986535259 5:8779954-8779976 TTAAGGGAGTATCCCTGAGTGGG - Intergenic
986895479 5:12361634-12361656 CTAAAGATGTGTCTGTGAGTCGG - Intergenic
987495018 5:18631854-18631876 CTAAGGATTCATCACTGAATGGG - Intergenic
993589404 5:89776190-89776212 CTAAATATGTATTCCTGTGTTGG - Intergenic
1002769116 6:274311-274333 CTCAGGTTATATGCCTGAGTTGG + Intergenic
1007375054 6:41450916-41450938 CTAATGATCTAGCCCTGTGTAGG - Intergenic
1007559109 6:42791181-42791203 CTCAGGATCTTTTCCTGAGTGGG - Intronic
1017078480 6:150642661-150642683 CTAAGGATGCAGCCATGATTGGG - Intronic
1017129458 6:151095531-151095553 CTAAGGATGTATCCCTGAGTAGG - Intronic
1017840786 6:158221098-158221120 ATAAGGAAGTAGTCCTGAGTCGG - Intergenic
1031985407 7:128161412-128161434 CTAAGGAAATAACCCTGTGTTGG - Intergenic
1032846989 7:135759492-135759514 CTAAGAATGTGTCTCTAAGTGGG + Intergenic
1034313030 7:150106715-150106737 GTAAGGAAGTATCCCTGATCAGG + Intergenic
1034793834 7:153993949-153993971 GTAAGGAAGTATCCCTGATCAGG - Intronic
1038265281 8:26034703-26034725 CTAAGGATGTAGCCTTGACATGG + Intronic
1039571517 8:38590448-38590470 CCAAGGCTGTGTCCCTGAGAAGG - Intergenic
1040931868 8:52743761-52743783 GTAAGTATGTAACCTTGAGTAGG - Intronic
1043176990 8:77033958-77033980 CTAGGGATGGATCCCAAAGTAGG - Intergenic
1053341865 9:37343534-37343556 CTCATGATTTATCCCTTAGTAGG - Intronic
1056891719 9:90500521-90500543 CTAAGAATATAGCCCAGAGTGGG + Intergenic
1059646022 9:116268821-116268843 TTATGGATGTTTCCCTAAGTAGG + Intronic
1188452163 X:30319083-30319105 CTAAGTATGTATCCCTTGTTTGG - Intergenic
1192930643 X:75802052-75802074 AAACGGATGTATCCCTGGGTAGG - Intergenic
1193185039 X:78501881-78501903 TTAAGGGTGAATCCCTGACTAGG + Intergenic
1195328420 X:103776730-103776752 AGAAGGGAGTATCCCTGAGTAGG + Intronic