ID: 1017131424

View in Genome Browser
Species Human (GRCh38)
Location 6:151111308-151111330
Sequence GTTACCTTTGAGCAATTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017131424_1017131425 -2 Left 1017131424 6:151111308-151111330 CCTTTCAATTGCTCAAAGGTAAC No data
Right 1017131425 6:151111329-151111351 ACCGACAAAAAGAAACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017131424 Original CRISPR GTTACCTTTGAGCAATTGAA AGG (reversed) Intergenic