ID: 1017134878

View in Genome Browser
Species Human (GRCh38)
Location 6:151139590-151139612
Sequence ATGAAAAGGAAAGGAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017134878_1017134883 15 Left 1017134878 6:151139590-151139612 CCTCTTCCTCCTTTCCTTTTCAT No data
Right 1017134883 6:151139628-151139650 TGAGTGACTGTGACATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017134878 Original CRISPR ATGAAAAGGAAAGGAGGAAG AGG (reversed) Intergenic
No off target data available for this crispr