ID: 1017134880

View in Genome Browser
Species Human (GRCh38)
Location 6:151139596-151139618
Sequence AGTTCCATGAAAAGGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017134880_1017134883 9 Left 1017134880 6:151139596-151139618 CCTCCTTTCCTTTTCATGGAACT No data
Right 1017134883 6:151139628-151139650 TGAGTGACTGTGACATGCTGAGG No data
1017134880_1017134884 25 Left 1017134880 6:151139596-151139618 CCTCCTTTCCTTTTCATGGAACT No data
Right 1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017134880 Original CRISPR AGTTCCATGAAAAGGAAAGG AGG (reversed) Intergenic