ID: 1017134883

View in Genome Browser
Species Human (GRCh38)
Location 6:151139628-151139650
Sequence TGAGTGACTGTGACATGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017134882_1017134883 1 Left 1017134882 6:151139604-151139626 CCTTTTCATGGAACTGATATTTA No data
Right 1017134883 6:151139628-151139650 TGAGTGACTGTGACATGCTGAGG No data
1017134881_1017134883 6 Left 1017134881 6:151139599-151139621 CCTTTCCTTTTCATGGAACTGAT No data
Right 1017134883 6:151139628-151139650 TGAGTGACTGTGACATGCTGAGG No data
1017134880_1017134883 9 Left 1017134880 6:151139596-151139618 CCTCCTTTCCTTTTCATGGAACT No data
Right 1017134883 6:151139628-151139650 TGAGTGACTGTGACATGCTGAGG No data
1017134878_1017134883 15 Left 1017134878 6:151139590-151139612 CCTCTTCCTCCTTTCCTTTTCAT No data
Right 1017134883 6:151139628-151139650 TGAGTGACTGTGACATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017134883 Original CRISPR TGAGTGACTGTGACATGCTG AGG Intergenic
No off target data available for this crispr