ID: 1017134884

View in Genome Browser
Species Human (GRCh38)
Location 6:151139644-151139666
Sequence GCTGAGGCCCTGTGCGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017134880_1017134884 25 Left 1017134880 6:151139596-151139618 CCTCCTTTCCTTTTCATGGAACT No data
Right 1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG No data
1017134882_1017134884 17 Left 1017134882 6:151139604-151139626 CCTTTTCATGGAACTGATATTTA No data
Right 1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG No data
1017134881_1017134884 22 Left 1017134881 6:151139599-151139621 CCTTTCCTTTTCATGGAACTGAT No data
Right 1017134884 6:151139644-151139666 GCTGAGGCCCTGTGCGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017134884 Original CRISPR GCTGAGGCCCTGTGCGAAGC TGG Intergenic
No off target data available for this crispr