ID: 1017134887

View in Genome Browser
Species Human (GRCh38)
Location 6:151139652-151139674
Sequence CCTGTGCGAAGCTGGAGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017134882_1017134887 25 Left 1017134882 6:151139604-151139626 CCTTTTCATGGAACTGATATTTA No data
Right 1017134887 6:151139652-151139674 CCTGTGCGAAGCTGGAGATCCGG No data
1017134881_1017134887 30 Left 1017134881 6:151139599-151139621 CCTTTCCTTTTCATGGAACTGAT No data
Right 1017134887 6:151139652-151139674 CCTGTGCGAAGCTGGAGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017134887 Original CRISPR CCTGTGCGAAGCTGGAGATC CGG Intergenic
No off target data available for this crispr