ID: 1017141228

View in Genome Browser
Species Human (GRCh38)
Location 6:151191786-151191808
Sequence CTGCGCATGTCAGACAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017141228_1017141231 12 Left 1017141228 6:151191786-151191808 CCAGGTCTGTCTGACATGCGCAG No data
Right 1017141231 6:151191821-151191843 CATCAGCCCTTGTCCTTCAGGGG No data
1017141228_1017141230 11 Left 1017141228 6:151191786-151191808 CCAGGTCTGTCTGACATGCGCAG No data
Right 1017141230 6:151191820-151191842 ACATCAGCCCTTGTCCTTCAGGG No data
1017141228_1017141229 10 Left 1017141228 6:151191786-151191808 CCAGGTCTGTCTGACATGCGCAG No data
Right 1017141229 6:151191819-151191841 GACATCAGCCCTTGTCCTTCAGG No data
1017141228_1017141235 30 Left 1017141228 6:151191786-151191808 CCAGGTCTGTCTGACATGCGCAG No data
Right 1017141235 6:151191839-151191861 AGGGGTTCAAATGCTACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017141228 Original CRISPR CTGCGCATGTCAGACAGACC TGG (reversed) Intergenic
No off target data available for this crispr