ID: 1017145068

View in Genome Browser
Species Human (GRCh38)
Location 6:151227398-151227420
Sequence GGCCAGGGGCTGTCATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017145063_1017145068 17 Left 1017145063 6:151227358-151227380 CCTGACTCAGGGACTCTCATGAG No data
Right 1017145068 6:151227398-151227420 GGCCAGGGGCTGTCATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017145068 Original CRISPR GGCCAGGGGCTGTCATCTCA AGG Intergenic
No off target data available for this crispr