ID: 1017146395

View in Genome Browser
Species Human (GRCh38)
Location 6:151239725-151239747
Sequence CCCTTCCCCCGGGGAACGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017146395_1017146411 27 Left 1017146395 6:151239725-151239747 CCCCCCGTTCCCCGGGGGAAGGG No data
Right 1017146411 6:151239775-151239797 CCTGACATCACTTGTTCCGGAGG No data
1017146395_1017146409 24 Left 1017146395 6:151239725-151239747 CCCCCCGTTCCCCGGGGGAAGGG No data
Right 1017146409 6:151239772-151239794 TCGCCTGACATCACTTGTTCCGG No data
1017146395_1017146408 -1 Left 1017146395 6:151239725-151239747 CCCCCCGTTCCCCGGGGGAAGGG No data
Right 1017146408 6:151239747-151239769 GGGGCGGCTAGCACTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017146395 Original CRISPR CCCTTCCCCCGGGGAACGGG GGG (reversed) Intergenic
No off target data available for this crispr