ID: 1017146510

View in Genome Browser
Species Human (GRCh38)
Location 6:151240242-151240264
Sequence CTCTGGTCCCGGCAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017146495_1017146510 29 Left 1017146495 6:151240190-151240212 CCCGAGGGCCGGGTGGGCGGCTG 0: 1
1: 0
2: 1
3: 19
4: 286
Right 1017146510 6:151240242-151240264 CTCTGGTCCCGGCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 301
1017146503_1017146510 0 Left 1017146503 6:151240219-151240241 CCTGGGCTGGCGCGTCGCAGCGC 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1017146510 6:151240242-151240264 CTCTGGTCCCGGCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 301
1017146496_1017146510 28 Left 1017146496 6:151240191-151240213 CCGAGGGCCGGGTGGGCGGCTGC 0: 1
1: 0
2: 4
3: 41
4: 258
Right 1017146510 6:151240242-151240264 CTCTGGTCCCGGCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 301
1017146502_1017146510 6 Left 1017146502 6:151240213-151240235 CCTGGACCTGGGCTGGCGCGTCG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1017146510 6:151240242-151240264 CTCTGGTCCCGGCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 301
1017146498_1017146510 21 Left 1017146498 6:151240198-151240220 CCGGGTGGGCGGCTGCCTGGACC 0: 1
1: 0
2: 1
3: 25
4: 209
Right 1017146510 6:151240242-151240264 CTCTGGTCCCGGCAGCCTGGGGG 0: 1
1: 0
2: 2
3: 31
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017146510 Original CRISPR CTCTGGTCCCGGCAGCCTGG GGG Intronic