ID: 1017147455

View in Genome Browser
Species Human (GRCh38)
Location 6:151247552-151247574
Sequence CAAGCAAATAAATTTAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 784}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017147455_1017147459 26 Left 1017147455 6:151247552-151247574 CCATCTTTAAATTTATTTGCTTG 0: 1
1: 0
2: 4
3: 74
4: 784
Right 1017147459 6:151247601-151247623 ACTTTTAAAATTTCTTCTCTTGG 0: 1
1: 0
2: 12
3: 118
4: 1005

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017147455 Original CRISPR CAAGCAAATAAATTTAAAGA TGG (reversed) Intronic
901377617 1:8850755-8850777 CAAGCAACTCAATTCAAAAATGG + Intergenic
901691700 1:10977675-10977697 CACGCAAATAAATTTCATGGGGG - Intronic
902264590 1:15252833-15252855 CAACCAAAGAAGTTGAAAGAAGG + Intronic
903863944 1:26384144-26384166 CAAACAACCAAATTTAAAAATGG + Intergenic
904693757 1:32315126-32315148 AAAGGAAATAATTTTAAAAAGGG + Intronic
905419627 1:37831737-37831759 AAAGCTAATAAACCTAAAGAAGG + Intronic
905454707 1:38080223-38080245 TAAACAAATAAATTAAAAGGGGG - Intergenic
905492851 1:38358481-38358503 CAAACAAACCAATTTAAAAACGG - Intergenic
905605540 1:39295982-39296004 TAAGCAACTAAATTTTAAGGTGG - Intronic
905804713 1:40867621-40867643 CAAATAAATAAAGTGAAAGAAGG + Intergenic
906343074 1:44997736-44997758 CAAACAAATAAATTTAAAGGTGG + Intergenic
906433131 1:45772317-45772339 CATTCAAATAAATTTATATATGG + Intergenic
906709573 1:47919222-47919244 GAAGTAAATAAATGTACAGATGG + Intronic
906800565 1:48733497-48733519 AAAGTAAAAAAATTTAAAAACGG + Intronic
907134239 1:52124186-52124208 CAAAAAAAAAAATTAAAAGAGGG - Intergenic
907176558 1:52528659-52528681 CAACCAAGTAAAATCAAAGATGG - Intronic
908816204 1:68037674-68037696 CAAGTAAATAATTTTAAATCAGG - Intergenic
909040937 1:70650658-70650680 TAAGCAAATATATTTATATATGG + Intergenic
909532959 1:76701231-76701253 GAAGAAAATAAATTTAAAAGAGG + Intergenic
910613447 1:89169863-89169885 CAAGCAAAGAAAATTTAAGAAGG - Intronic
910996531 1:93110348-93110370 CCAGCATGTAAATTTGAAGAGGG + Exonic
911107427 1:94145974-94145996 CAAGTAAATAAACTAAAAAACGG + Intergenic
911241062 1:95467302-95467324 CAAGTAAATAAAATCAAAGATGG - Intergenic
911300750 1:96170311-96170333 AAAGAAAATAATTTTAAAAATGG + Intergenic
911354642 1:96800982-96801004 TTACCAAAAAAATTTAAAGATGG - Intronic
911411872 1:97520038-97520060 CATGCAAAGAAATTTTAAGTTGG - Intronic
911459240 1:98168775-98168797 CAATCAAACCATTTTAAAGAGGG + Intergenic
911491531 1:98575166-98575188 CAAGCAAAAAAAAAGAAAGAAGG + Intergenic
911586822 1:99700892-99700914 CAAGTAACAAAATTTAAAAATGG - Intergenic
912081130 1:105937671-105937693 CAAATAACTAAATTTAAAAAGGG - Intergenic
912148317 1:106822265-106822287 TAAACAAATTAATTTAAAAATGG - Intergenic
912327372 1:108780749-108780771 AAAAAAAGTAAATTTAAAGAAGG - Intronic
912888875 1:113506323-113506345 AAAGCAGATAAATTAAAAGGAGG + Intronic
913537975 1:119792599-119792621 AAAGCAAATAAATTAGGAGAGGG + Intergenic
913989824 1:143600744-143600766 CATGCAAATAAATTCAAATGGGG + Intergenic
914389913 1:147211251-147211273 CAAGCCAATGATATTAAAGATGG + Intronic
914741270 1:150467360-150467382 CAAACAAATAAAAATAAAAAGGG - Intronic
915001034 1:152591758-152591780 CAAGAAAAAAAATTTGAACATGG - Intronic
915958437 1:160243300-160243322 GAAGGAAATAAATGGAAAGAAGG + Intronic
916367259 1:164045072-164045094 AAAGCAAATAATTTTATAAAGGG - Intergenic
916385768 1:164266596-164266618 CAAAAAAATTAATTCAAAGATGG + Intergenic
916756595 1:167776484-167776506 CAAGGAAATGAATCTAATGAAGG + Intronic
916929666 1:169562501-169562523 ATAGAAAATAAATATAAAGATGG - Intronic
917143097 1:171857449-171857471 GAAGTAAATAAGTTTAGAGAGGG + Intronic
917150483 1:171938451-171938473 CAAGCACATAATTTTAAATCTGG + Intronic
917242468 1:172963560-172963582 CCAGCAAATATATGAAAAGAAGG + Intergenic
918133817 1:181652422-181652444 ACAGAAAATAAATTTTAAGAAGG + Intronic
918235498 1:182576519-182576541 AAAGCAAAATAATTTAAAAATGG + Intronic
918439238 1:184549317-184549339 AAAGCAAAGTACTTTAAAGAAGG - Intronic
918696031 1:187547591-187547613 AAAACAAAAAAATTTAGAGATGG - Intergenic
918760863 1:188405071-188405093 CAAGGCCATAAAATTAAAGAAGG - Intergenic
918791139 1:188830927-188830949 CAAGCACTTAAATTGAAACAAGG + Intergenic
918928748 1:190824675-190824697 CAAGCAACCCAATTTAAAAATGG + Intergenic
919037003 1:192325233-192325255 TAAGCAAATTAATTCAGAGACGG - Intronic
919169642 1:193937861-193937883 CAAAAAAATAAATTCAATGAGGG + Intergenic
919197776 1:194311071-194311093 CAATCCAAAAAATATAAAGAAGG - Intergenic
919585166 1:199429306-199429328 CTAACAAATAAATTTAACCAAGG + Intergenic
919624497 1:199898126-199898148 AAAACAAAAAAATTTACAGAGGG - Intergenic
919754779 1:201059840-201059862 CAAGGAAGTAGATTTAAGGAGGG - Intronic
920083010 1:203390061-203390083 CAAACAACTCAATTAAAAGATGG - Intergenic
920945856 1:210527915-210527937 CAAGCAAATAAATAAACAAATGG + Intronic
920966057 1:210701633-210701655 CAGGCAAATAAAAAAAAAGATGG - Intronic
921404775 1:214766465-214766487 CAAGCAACCCAATTTAAAAATGG - Intergenic
921482913 1:215684098-215684120 CATGCATATAAAGTTAAAGAAGG - Intronic
921574823 1:216822484-216822506 CAAATCAATAAATTTAAAGAAGG + Intronic
922158679 1:223061381-223061403 CAAGCACATTCATTTAAAAAGGG - Intergenic
922228372 1:223665252-223665274 CAAAAAAATAAAATTAAAAAAGG + Intronic
922445368 1:225692573-225692595 AAAATAAATAAATTTAAAAAGGG - Intergenic
922709920 1:227819687-227819709 CTTGGAAATAAATTTAATGAAGG - Intronic
922711282 1:227834994-227835016 CAAGCAACCCAATTTAAAAATGG + Intronic
922789522 1:228303541-228303563 TAAGCAAATGAATATACAGATGG - Intronic
922964898 1:229680756-229680778 TAAACAAACAAATTTAAAAATGG - Intergenic
923694874 1:236238257-236238279 CAAGGAAAACAATTTACAGATGG + Intronic
924221940 1:241886151-241886173 CAAGAATAAAATTTTAAAGAAGG + Intronic
1063633436 10:7756838-7756860 GAAGAAAATAAAGTTAAAGTTGG - Intronic
1065242242 10:23718457-23718479 CAAACAAAAAGATTTAAACATGG - Intronic
1065439398 10:25734927-25734949 CAAACAAACAAATTTAAAAGTGG + Intergenic
1065468324 10:26049440-26049462 AAAGGAGATAATTTTAAAGATGG + Intronic
1065583181 10:27192108-27192130 CAAGTAAATAAAATCAAAGATGG + Intergenic
1066275329 10:33863100-33863122 AAAGAAAAGAAATTTAAAGTGGG + Intergenic
1066291913 10:34022213-34022235 CAAGCCAATAACATTCAAGACGG + Intergenic
1066419801 10:35254281-35254303 CAAGCAAACACATTTACTGATGG - Intronic
1066674070 10:37870208-37870230 CAGGCAAATAAATGTGAAGTTGG - Intergenic
1066735383 10:38472567-38472589 CTAGCAAATAAATTTACCTATGG - Intergenic
1067253983 10:44617056-44617078 CAAACAAATAGATTAAAACATGG + Intergenic
1067470292 10:46532201-46532223 CAAGCAACCCAATTTAAAAATGG - Intergenic
1067508128 10:46873683-46873705 CAAACAAACAAAAATAAAGATGG - Intergenic
1067654123 10:48178162-48178184 CAAACAAACAAAAATAAAGATGG + Intronic
1068301102 10:55141019-55141041 CAAAGAAATCAATTTAAAAAAGG - Intronic
1068362348 10:55994209-55994231 AAAGTAAATAAATTACAAGATGG - Intergenic
1069435007 10:68373090-68373112 TAAGCAAATTATATTAAAGAGGG + Intronic
1070238081 10:74651326-74651348 CTATCAAAAAATTTTAAAGAAGG - Intronic
1071623112 10:87141115-87141137 CAAAAAAAAAAATTTAAAAAGGG + Intronic
1071756587 10:88548303-88548325 AAAGAAAATAAAATTAAATAGGG + Intronic
1071797536 10:89022472-89022494 CAAGCAAATATATGAAGAGATGG - Intergenic
1072141934 10:92596698-92596720 AAAGCAAACCAATTTAAAAATGG - Intronic
1072879689 10:99214017-99214039 CAAATAAATGAATTTAAAAAGGG + Intronic
1073200497 10:101731302-101731324 CAAACAATTCAATTTAAAAATGG - Intergenic
1073663273 10:105501539-105501561 TAAGAAAATAAATTTAATAAGGG + Intergenic
1074056325 10:109925493-109925515 CAAACAAAAAAACTTCAAGAGGG - Intergenic
1074373184 10:112917066-112917088 AAAGTAAATAAATAAAAAGAGGG + Intergenic
1074622593 10:115141040-115141062 CAAGCACATAATTATAAACAGGG - Intronic
1074722108 10:116272535-116272557 CAAGCAAATAAATAAATAAACGG + Intronic
1074806014 10:117053423-117053445 CAAACAACTCAATTTAAAAATGG + Intronic
1074954548 10:118375658-118375680 CAAAGAAATAAGGTTAAAGATGG + Intergenic
1074957077 10:118402148-118402170 CAAACAACTCAATTTAAAAATGG - Intergenic
1075294196 10:121259162-121259184 CACTCAAAGAAATATAAAGAAGG + Intergenic
1075891474 10:125954918-125954940 CAAAAAAATAAATTAAAAAAAGG + Intronic
1075958002 10:126541509-126541531 CAAGCAATCCAATTTAAATATGG + Intronic
1076740871 10:132483936-132483958 CAAAGAAATAAATTTAAAAATGG + Intergenic
1077737951 11:4811470-4811492 TAAGCAAATTAACTTAAAGCAGG - Intronic
1078171993 11:8935186-8935208 TAAGCTGATAAATTTAAACAAGG + Intergenic
1078547892 11:12259517-12259539 CAAGTAAATAATTTGAAATATGG - Intronic
1079568141 11:21908489-21908511 CAAAGGAATGAATTTAAAGAAGG - Intergenic
1079589052 11:22160114-22160136 TAAGTAAATAAATAAAAAGAGGG + Intergenic
1079826073 11:25195256-25195278 CAAGAAAATACATTTAAACCAGG - Intergenic
1079969037 11:27013744-27013766 CAAACAGATAAATTAACAGACGG + Intergenic
1080144019 11:28957792-28957814 CTAGCAAATGAATTTCAGGATGG + Intergenic
1080190458 11:29539461-29539483 TAAGAAAATAAATAGAAAGAAGG + Intergenic
1080285351 11:30605354-30605376 CCAACAAATCAATTTAAAGGGGG + Intergenic
1080323152 11:31038338-31038360 CAAGAAAATAAAATTAAGTATGG - Intronic
1080499709 11:32858746-32858768 CAAACAAGTCAATTTAAAAATGG + Intergenic
1080746610 11:35113925-35113947 TAAAAAAATAAATTTAAAAAGGG + Intergenic
1080759452 11:35234157-35234179 AAAGCAAATAAATGGAAACAGGG + Intergenic
1081104070 11:39042828-39042850 AAAGCAAGTCTATTTAAAGAAGG - Intergenic
1081170135 11:39858206-39858228 AAACCAAATAAAGCTAAAGAAGG - Intergenic
1081726600 11:45334191-45334213 CAAATAAATAAATATAAATAAGG - Intergenic
1082129290 11:48468950-48468972 ATAGCAAAAAAATTTAAAAATGG - Intergenic
1082901204 11:58254979-58255001 CAAGCAAATACATTGCAAGAAGG - Intergenic
1083051938 11:59785222-59785244 TAAGCCAATATATTTATAGAGGG + Intronic
1083133049 11:60644865-60644887 AAAGCAACCAAATTTAAAAATGG - Intergenic
1083209976 11:61177438-61177460 GAATCAAATAAATTTGAACATGG - Intergenic
1083980211 11:66161473-66161495 CAAATAAATAAAAATAAAGAAGG + Intronic
1085158162 11:74315114-74315136 CAATCAAGAAAATTTGAAGAAGG - Intergenic
1085267140 11:75243595-75243617 CAAGCCAATATATTAAAGGAAGG - Exonic
1085567974 11:77531892-77531914 CAACAAAAAAAATTTAAAGAAGG - Intronic
1085661095 11:78367580-78367602 CAAGCAAAACACTTTATAGATGG + Intronic
1085728968 11:78980033-78980055 AGAGAAGATAAATTTAAAGAAGG + Intronic
1085847684 11:80084423-80084445 CAAGTAAACAAATGTACAGATGG + Intergenic
1086181125 11:83952964-83952986 AAAGCAAATGGATATAAAGATGG + Intronic
1086203368 11:84230080-84230102 CAAGCCAATGAACTTAAAGAAGG + Intronic
1086270606 11:85061068-85061090 AAAGCAAAAAAATTAAAAAATGG - Intronic
1086580028 11:88388798-88388820 CACGCAAAATAATTTAAAAATGG - Intergenic
1087133480 11:94691037-94691059 CAAGCAACTCAATATCAAGAAGG + Intergenic
1087162832 11:94966689-94966711 AAAGAAAATAGATTTAAATATGG - Intronic
1087334398 11:96825125-96825147 CAAGAATATAAATATAAAGCTGG + Intergenic
1087487675 11:98777469-98777491 CATGCAAAGACATTTAAAGTGGG + Intergenic
1087555479 11:99714149-99714171 CAAGTAAATATATTTTAATATGG + Intronic
1087838269 11:102896608-102896630 CAAACAATTCAATTTAAAAATGG - Intergenic
1088188548 11:107200723-107200745 AAAGTAAATAAATAGAAAGACGG - Intergenic
1088532137 11:110821868-110821890 CTAGCAACTCAATTTGAAGAAGG + Intergenic
1090539203 11:127681920-127681942 CAAATAAATAACTTTAAATATGG + Intergenic
1091096862 11:132831568-132831590 GAAGCAAGTCTATTTAAAGATGG - Intronic
1091310320 11:134570330-134570352 TAAGCAAATAAACCTACAGAGGG + Intergenic
1091367198 11:135032259-135032281 CAAGAAAATAAATTTTACAAAGG + Intergenic
1091471754 12:734468-734490 AAAAAAAATAAATTTCAAGAAGG - Intergenic
1091870999 12:3891252-3891274 CACGCAAATATATGTAAAGCTGG + Intergenic
1091914354 12:4258167-4258189 AAAGCAAATAAGTTTAAAGATGG - Intergenic
1092317787 12:7438179-7438201 TAAGGAAATCATTTTAAAGAAGG - Intronic
1093053228 12:14528710-14528732 AAAGAAAATAAATATAAAAATGG + Intronic
1093175931 12:15913146-15913168 CAAATAAATAAATTTAAAAATGG - Intronic
1093226123 12:16485863-16485885 CATCAAAATAAATTCAAAGAAGG + Intronic
1093486590 12:19659638-19659660 TAAGTAAATAAATTTAAGAAAGG - Intronic
1093513267 12:19954078-19954100 CAACCAAATAAACCTAAATAAGG - Intergenic
1093606685 12:21099005-21099027 CAAGCAATTTAATTTTAAAAAGG - Intronic
1093734235 12:22601838-22601860 CCAGAAAATAAATTAAAAAATGG + Intergenic
1093956410 12:25224437-25224459 CAAACAAAAAATTTTAAATATGG + Intronic
1095219000 12:39586022-39586044 TAAGCACATAAGTGTAAAGATGG - Intronic
1095263131 12:40121415-40121437 CAAGCAACTCAATTAAAAGATGG + Intergenic
1095961371 12:47836315-47836337 AAATCAGATAAATATAAAGAGGG + Intergenic
1096765173 12:53881349-53881371 AAGGCAAACTAATTTAAAGATGG + Intergenic
1096849562 12:54426967-54426989 CAGGGAAATAAATCCAAAGATGG - Intergenic
1097459049 12:59837366-59837388 CAAGCAACCCAATTTAAAAATGG - Intergenic
1097583993 12:61493294-61493316 CAACAAAATAAATTTAAAGTAGG - Intergenic
1098122380 12:67255917-67255939 CAAGTAAATAAATATGCAGAAGG - Intergenic
1098727627 12:73988576-73988598 CAAGCTAAAAAATTGAAATATGG - Intergenic
1098733816 12:74071315-74071337 CAAGAAAAAAAAATTAAAAATGG + Intergenic
1098766185 12:74492247-74492269 AAATCAAATAAATATAAACAAGG + Intergenic
1098825557 12:75292938-75292960 AAAAGAAATAAATTTAAAAAAGG - Intronic
1099193121 12:79581568-79581590 TGAGAAAATAAATTTTAAGAAGG + Intronic
1099673167 12:85720525-85720547 AAAACACATAAATTTAAATAAGG + Intergenic
1099950692 12:89299417-89299439 CAAACAATCAAATTTAAAAATGG + Intergenic
1100069938 12:90702584-90702606 CAAGGATATAAATAAAAAGAAGG - Intergenic
1100511111 12:95274845-95274867 GAAGCACATAACTTTACAGATGG + Exonic
1101695845 12:107125656-107125678 CAAGCCAATAAATTAAACAAGGG - Intergenic
1101868279 12:108540330-108540352 TAAGAAAATAATTTTCAAGAAGG + Intronic
1103979637 12:124728023-124728045 CAAATAAATAAATAAAAAGAAGG + Intergenic
1105334497 13:19453779-19453801 CAAGAACAGAAATTAAAAGATGG + Intronic
1105354631 13:19647868-19647890 TAAGGAAATCATTTTAAAGAAGG + Intronic
1105860429 13:24405594-24405616 CAAGAACAGAAATTAAAAGATGG - Intergenic
1106000281 13:25716157-25716179 CAAGCAACCCAATTTAAAAACGG - Intronic
1106060811 13:26289536-26289558 CAAACAAGCAAATTTCAAGATGG - Intronic
1106279015 13:28246230-28246252 CAAACAAGTAAATTTAAAACTGG - Intronic
1106337112 13:28793741-28793763 TAATAAATTAAATTTAAAGAGGG - Intergenic
1106428073 13:29652375-29652397 AAAGAAAATAAATTTTAAAATGG - Intergenic
1106501576 13:30334351-30334373 CAATTAAAGAAATTTAAAAACGG - Intergenic
1106556396 13:30812240-30812262 CAAACAAATAAATTGAATGGGGG - Intergenic
1107146045 13:37061263-37061285 CAAACAACTCAATTTAAAAATGG - Intergenic
1107488713 13:40858752-40858774 CAAGAACAGAAATTAAAAGATGG + Intergenic
1107751905 13:43576911-43576933 TAAAGAAAGAAATTTAAAGAAGG + Intronic
1108067109 13:46589443-46589465 CAACTAGATAAATTTAAATATGG - Intronic
1108147644 13:47496513-47496535 AAAGAAAATAAATTTTAAAATGG + Intergenic
1108194684 13:47981274-47981296 CAAACAAAAAAATTTAAAGATGG + Intronic
1108539880 13:51431224-51431246 AAAGGATATAAATTTCAAGAGGG + Intronic
1109068316 13:57730275-57730297 CAAGCAAATAAATGAACAAAAGG - Intergenic
1109089363 13:58020444-58020466 CTATCAGATAAATTTCAAGACGG + Intergenic
1109090088 13:58031308-58031330 CAAGTAATTAAATTTCAACAAGG + Intergenic
1109336350 13:60999627-60999649 TAAGTAAATAAAATCAAAGACGG - Intergenic
1109920296 13:69048490-69048512 CAAGGACATAAATTTAAATCTGG - Intergenic
1110107241 13:71692827-71692849 CAAGAAAATACATTTAAAATAGG - Intronic
1110178958 13:72592395-72592417 CGAATAAATAAATTTTAAGAGGG - Intergenic
1110805648 13:79751345-79751367 CAAGGGAATAACTTAAAAGAGGG - Intergenic
1111299491 13:86328954-86328976 CAAACATATAAATGTAAACATGG - Intergenic
1111314558 13:86536006-86536028 GAAGCAAATACAAATAAAGAAGG - Intergenic
1111841785 13:93458368-93458390 CAAGCAAATAAATACAAAAATGG - Intronic
1112138709 13:96613788-96613810 CTAGCAAATTAATAAAAAGAGGG + Intronic
1112527601 13:100167036-100167058 CAAGCAACTCAATTTAAAAATGG - Intronic
1112723333 13:102272204-102272226 CAAGCCAAGAAAGTGAAAGAGGG - Intronic
1113013384 13:105796712-105796734 CTAGAAAATAAATTTAAAATGGG - Intergenic
1113234087 13:108250230-108250252 CAAACAAACCAATTTAAAAATGG + Intergenic
1113429603 13:110238026-110238048 CAAGCAGAGAACTTTGAAGATGG - Intronic
1113431915 13:110258240-110258262 CAAGAAAATAAAATTTAAGCCGG + Intronic
1114169702 14:20259995-20260017 CAGGCAAATAAATAAAAGGAAGG + Intronic
1114859016 14:26492102-26492124 CCTGCAAATAAATTTAACCAAGG - Intronic
1115721449 14:36165551-36165573 AAAGCAGTTAAATTTAAGGATGG + Intergenic
1115833422 14:37369226-37369248 GAAGTAAATAATTTTAAATATGG + Intronic
1116006999 14:39304279-39304301 GAAGCATTTAACTTTAAAGAAGG - Exonic
1116069910 14:40030738-40030760 CAAGAAACTATATTTAGAGAAGG + Intergenic
1116196006 14:41725860-41725882 AAAGCAAATAAATATAAAATTGG - Intronic
1116543582 14:46133921-46133943 CCAGCAAAGAAAGTTTAAGAGGG + Intergenic
1116582312 14:46657928-46657950 GAAGCATATAACTTGAAAGAAGG - Intergenic
1116622371 14:47222444-47222466 AAAGCAAACAAAATTAAAAAGGG + Intronic
1116688572 14:48075226-48075248 CAAGAAAATAAGTTTTAACATGG + Intergenic
1116804721 14:49481682-49481704 CATGAAAATAAATACAAAGATGG - Intergenic
1117078055 14:52123672-52123694 TAAGCAAATAAAATCAAAGAAGG - Intergenic
1117177961 14:53164599-53164621 CAATCAAATTGATTTAAGGAAGG - Intergenic
1117367372 14:55042225-55042247 CAAGCAGATAAATTTCTATAAGG - Intronic
1117397306 14:55323369-55323391 AAAATAAATAAATTTAAAGGGGG - Intronic
1117539269 14:56730761-56730783 CCAGCAAATTAATTTTAAAATGG + Intergenic
1119153432 14:72386764-72386786 CAATCAAATAACTTGAAATATGG + Intronic
1119565472 14:75625324-75625346 CAAGCAAATGAAATGAAAGAGGG - Intronic
1120087458 14:80290174-80290196 CAAGCAAACCAATTTAAAAATGG - Intronic
1120194385 14:81466511-81466533 CAAACAAATATATATATAGATGG + Intergenic
1120312578 14:82849561-82849583 CAAACAATTCAATTTAAAAATGG + Intergenic
1120350439 14:83350813-83350835 CATGGAAATAAATTTAAATTTGG + Intergenic
1120418305 14:84248672-84248694 CAAACAAATAAATAAAAATAAGG - Intergenic
1120507042 14:85365702-85365724 AAAGCAAATAAATTATGAGAGGG + Intergenic
1120697670 14:87662076-87662098 CCAGGAAACAAATTTAAAAATGG + Intergenic
1120816276 14:88862315-88862337 CAAGCAATCCAATTTAAATATGG - Intronic
1121363072 14:93279920-93279942 CAAGCAAATAAAGGTAACAATGG - Intronic
1121552414 14:94812712-94812734 CAAAAAAATAAATTCATAGATGG - Intergenic
1122168205 14:99847192-99847214 GATTGAAATAAATTTAAAGATGG - Intronic
1124433514 15:29628302-29628324 CAAGCAACTCAATTTAAAAATGG - Intergenic
1124937982 15:34190609-34190631 AAAGCAAAAACAGTTAAAGAAGG + Intronic
1125010195 15:34863791-34863813 GAATCAAATAAATGTGAAGAGGG + Intronic
1125075899 15:35617949-35617971 CAAGCAAATAATTTAAAAAATGG + Intergenic
1125167739 15:36728518-36728540 CAAGCAAAGATATTTAGAGGTGG - Intronic
1125223698 15:37369881-37369903 CAAGAAAAAAAATTCCAAGATGG + Intergenic
1125280303 15:38035738-38035760 CAAGCAAATAAACTTTGAGGGGG - Intergenic
1126075851 15:44908513-44908535 CAGAAAAATAAACTTAAAGATGG + Intergenic
1126126899 15:45302720-45302742 CAAGCAACTCAGTTTAAAAATGG - Intergenic
1126536860 15:49775780-49775802 GAAGCAAACAAATTTAAAATGGG + Intergenic
1127018927 15:54723218-54723240 CAAGCAGACAAACTTAAAAATGG - Intergenic
1127342062 15:58057291-58057313 CAAGCTAATCAAATTACAGAAGG + Intronic
1127597502 15:60500930-60500952 CAACCAAATAAAAATAAAAATGG - Intronic
1127923400 15:63513329-63513351 CAAGGACAAAGATTTAAAGAAGG - Intronic
1128503418 15:68246852-68246874 CAAATAAATAAAATTAAAAATGG + Intronic
1128522335 15:68383966-68383988 AAAGAAAATAAATTTAACGTGGG - Intronic
1128774106 15:70306493-70306515 AAAGAAAAAAAATTTAAAAAAGG - Intergenic
1129083131 15:73059385-73059407 CTATGAAATAATTTTAAAGAAGG - Intronic
1129514346 15:76147969-76147991 AAAATAAATAAATTTAAAAAAGG + Intronic
1130194382 15:81765337-81765359 CAAACAATTATATTTACAGATGG - Intergenic
1130366285 15:83242467-83242489 CAAACAAAATAATTTAAAAATGG + Intergenic
1131595144 15:93790809-93790831 GTGACAAATAAATTTAAAGAAGG - Intergenic
1131653499 15:94428853-94428875 CAAGGAAATTCTTTTAAAGATGG - Intronic
1131656551 15:94466423-94466445 CAAGCAAAAAAATTTAAGAAAGG - Intronic
1131748877 15:95483420-95483442 TAATAAAATAAATTTAAAAAAGG + Intergenic
1132164301 15:99570456-99570478 CAAGCATATAATTTTAATAATGG - Intronic
1132437894 15:101825791-101825813 GATGCAAATAAATTTAACAATGG + Intergenic
1133367238 16:5219984-5220006 CAAGTACATAAATTTAATGCAGG + Intergenic
1133916671 16:10115317-10115339 ATAGCAAGTAACTTTAAAGAAGG - Intronic
1134557163 16:15175272-15175294 CAAGCAGACAAATTTCAAAAAGG + Intergenic
1134749779 16:16616841-16616863 CAAGGAAATAATTTTAAATCTGG + Intergenic
1134917741 16:18086983-18087005 CAAGCAGACAAATTTCAAAAAGG + Intergenic
1134995694 16:18736774-18736796 CAAGGAAATAATTTTAAATCTGG - Intergenic
1136355477 16:29742607-29742629 AAAGCAAATAATTGTACAGATGG + Exonic
1140035449 16:71368091-71368113 CAAGGAAATGAATTTAAACATGG - Intronic
1140072546 16:71664125-71664147 GCAGCAAATAAACTTAAAGGAGG - Intronic
1140129909 16:72151310-72151332 GAAGAAAATAAATCTAAACAAGG - Intronic
1140203940 16:72918205-72918227 CAAGCAAATAAGTCAAAAGCAGG + Intronic
1141024221 16:80528803-80528825 CAACCAAATAGATTTACAAAAGG + Intergenic
1141121241 16:81358896-81358918 CAAGCAAACACAATTAAATAAGG - Intronic
1141243445 16:82284448-82284470 GAAAAAAATAAATTAAAAGACGG - Intergenic
1141578241 16:84979343-84979365 CAACCAAATAAAATCAAAGGTGG + Intronic
1141980765 16:87548703-87548725 CAAGCAAGAAAATAGAAAGATGG + Intergenic
1142896926 17:2986365-2986387 CAAGCAAAGAACTTTAATTAGGG - Intronic
1144413416 17:15022872-15022894 AATTCAAATCAATTTAAAGAAGG - Intergenic
1144606321 17:16668338-16668360 CAGGAAAATAAACTTAAATATGG - Intergenic
1144612968 17:16741134-16741156 CAGAAAAATAAATTTAAACAAGG - Intronic
1144899815 17:18574459-18574481 CAGAAAAATAAATTTAAACAAGG + Intergenic
1145132629 17:20371211-20371233 CAGAAAAATAAATTTAAACAAGG - Intergenic
1145808365 17:27750615-27750637 AAAACAAATAAAACTAAAGAAGG + Intergenic
1146250871 17:31342798-31342820 CAAGCATATAAATAAGAAGATGG - Intronic
1146417750 17:32652734-32652756 CAAGCAAATACATTCATAGCAGG + Intronic
1147354394 17:39882467-39882489 CAATCAATTAAATTGAAAGCAGG - Intergenic
1147411387 17:40255316-40255338 AAAAAAAAAAAATTTAAAGATGG - Intronic
1147545314 17:41396765-41396787 CAAGCAAAGAAATGCAAAAATGG - Intronic
1147589563 17:41673197-41673219 AAAGCAAAGAAATTTAAAAATGG + Intergenic
1148146441 17:45368008-45368030 CAAACAACTAAATGTAAAGATGG + Intergenic
1148254548 17:46118189-46118211 CAAGCAAATAAAACTAACGTCGG - Intronic
1149131166 17:53304020-53304042 CAAGCAACTGTATTTAAAAATGG + Intergenic
1149297804 17:55276411-55276433 CAAGAAAATGAATATAAATAAGG + Intronic
1149406270 17:56354777-56354799 CAAGCAAAGAAAGATAAACATGG - Intronic
1149619900 17:58036295-58036317 CAAGCAACTCAATTTAAAAATGG + Intergenic
1149761709 17:59237621-59237643 AAAGCATATAAATTTCAAAATGG + Intronic
1150190791 17:63236119-63236141 CAAGGAAATAAATTTAAATGAGG + Intronic
1150855757 17:68750966-68750988 CATTCAAATACCTTTAAAGAGGG - Intergenic
1151168979 17:72229957-72229979 CAAACAACTCAATTTAAAAATGG - Intergenic
1151483636 17:74385071-74385093 AAAAAAAAAAAATTTAAAGAGGG + Intergenic
1153440022 18:5106312-5106334 CAATCAAATGAATTTAATGTAGG + Intergenic
1153840041 18:8999015-8999037 CAAGCAAATAAACTTGGAGAGGG + Intergenic
1154986808 18:21559970-21559992 CAAGCATATGAATTTAACGGAGG + Intronic
1155299547 18:24416863-24416885 CAAGTACAACAATTTAAAGAAGG + Intergenic
1155323717 18:24645065-24645087 CAAAGAAATAAAATGAAAGATGG - Intergenic
1155859365 18:30877727-30877749 CAAGTAAATAAATTTTAAGGAGG + Intergenic
1156120195 18:33833714-33833736 CAAACAAATAAAATTCAAGACGG - Intergenic
1156620187 18:38842458-38842480 GAAGCAAAGAAATATGAAGAAGG - Intergenic
1156711543 18:39952713-39952735 CTAGCAAAGAAAATTGAAGAAGG - Intergenic
1157367320 18:47077140-47077162 CAAGTAAATGAATATAATGATGG - Intronic
1157558610 18:48630568-48630590 CAAGCAAATTAATGTACAAATGG - Intronic
1158335290 18:56409763-56409785 CAATCAAATTAATATTAAGATGG - Intergenic
1158523692 18:58193845-58193867 CCAGGAAATAAATTTAAAAAGGG - Intronic
1158718536 18:59901206-59901228 CAATCAAATCAAGTTTAAGAGGG - Intronic
1158729560 18:60008042-60008064 CAAGCAAATAAAATGACATATGG - Intergenic
1158844406 18:61426493-61426515 CAAGCAAATAAACTGAAAAATGG - Intronic
1159133129 18:64303983-64304005 CAAGCATATTAAAATAAAGAAGG - Intergenic
1159494652 18:69186461-69186483 CCAGAAAATAAATTTAGAAATGG - Intergenic
1159829823 18:73262600-73262622 CATGAAAATAAAATGAAAGAGGG - Intronic
1162106294 19:8371713-8371735 TAAGTAAATAAAAGTAAAGACGG - Intronic
1162305210 19:9868588-9868610 AAATAAGATAAATTTAAAGATGG - Intronic
1163707748 19:18825632-18825654 CGAGCAAATAAACCCAAAGAGGG - Intergenic
1164099312 19:22040450-22040472 CATGCAAAGAAAGTTGAAGATGG - Intergenic
1164247309 19:23442645-23442667 CAACAAATTTAATTTAAAGATGG - Intergenic
1164943120 19:32267045-32267067 CAAGAAGATAAATATGAAGAGGG + Intergenic
1165170141 19:33886605-33886627 TAAATAAATAAATTTAAAAAAGG - Intergenic
1165492458 19:36132467-36132489 CAAGCAAATAATTTTTATCAGGG + Intergenic
1165609636 19:37139904-37139926 AAAACAAATCAATTTAAAAACGG + Intronic
1167009727 19:46799349-46799371 CAAGGAATTTAATTTAGAGATGG - Intergenic
1167862932 19:52299645-52299667 CTAGCAAATTAATCAAAAGAAGG + Intronic
925328104 2:3038395-3038417 GAATCAAATCAATTTAAAGGAGG - Intergenic
925656578 2:6156255-6156277 CACACAAATGAATTGAAAGATGG - Intergenic
926210357 2:10864680-10864702 CAAGCAAAGAAATGAAGAGACGG - Intergenic
927160899 2:20259758-20259780 AAAGCAAATGAATTGAAAGCAGG - Intronic
927173276 2:20388077-20388099 CAGGCAAATATATTTAAAATAGG - Intergenic
927180034 2:20438943-20438965 TAAGCAACTAAAATAAAAGATGG + Intergenic
927264182 2:21125744-21125766 CAAACAAATAAATTAGGAGATGG - Intronic
927414361 2:22862317-22862339 TAAACAAATAAATAAAAAGATGG + Intergenic
927625781 2:24716975-24716997 CAAGCAACTCAATTTAAAAATGG + Intronic
927817491 2:26232104-26232126 CAAGAAAACAGATCTAAAGAGGG + Intronic
928702036 2:33908766-33908788 CAAACAAATAAATTAGAAGGAGG - Intergenic
928717954 2:34084820-34084842 AAAACAAATAACTTTAAAAATGG - Intergenic
928910898 2:36419750-36419772 TGAGTAAATAAATTTAAAGGGGG + Intronic
929213766 2:39388379-39388401 CAAGCAAATAAATTCACAGGTGG + Intronic
929708357 2:44239992-44240014 AAAGGAACTAAATTTAAATATGG - Intronic
930630828 2:53753330-53753352 CAAACAAATAAATAAACAGATGG + Intronic
931114067 2:59145461-59145483 CAAGCCAGGAAATTTAAAAAGGG + Intergenic
931148632 2:59547723-59547745 CCAGGAAGTAAATATAAAGAAGG + Intergenic
932149748 2:69359837-69359859 CAAACAAGTAAATTTAACTATGG - Intronic
932888470 2:75569501-75569523 CAAGCAAAGCCAGTTAAAGAAGG - Exonic
933001437 2:76929159-76929181 CAAGGAAATAAAATTAAATTAGG + Intronic
933250618 2:80024895-80024917 CATGCAAATGAATTGAAAGATGG + Intronic
933644273 2:84798081-84798103 AAAGCAGATAAATTAAAACATGG + Intronic
935134553 2:100288412-100288434 CAACCAAAGAATTTAAAAGAGGG + Intronic
936042790 2:109162389-109162411 TAAATAAATAAATTTAAAAAAGG - Intronic
936277118 2:111108947-111108969 TAAACAAATTAATTTAAAAAAGG - Intronic
936279743 2:111127610-111127632 CAGACAAATAAAGTTGAAGAAGG + Intronic
936809248 2:116376559-116376581 CAAAAAAGTAAATTTAAAAATGG + Intergenic
937792850 2:125980810-125980832 CAATCAAATCAATTTTAAAATGG + Intergenic
937824707 2:126356078-126356100 TAAGTAAACAAATATAAAGATGG + Intergenic
938979276 2:136510254-136510276 CAAGCCAATATATTCAAAGTAGG - Intergenic
939027376 2:137030278-137030300 TATACAAATAGATTTAAAGATGG + Intronic
939251686 2:139688788-139688810 CTATCAAACAAAATTAAAGAGGG + Intergenic
939433192 2:142137718-142137740 GAAGCAAAGAAATTTTAAAAAGG + Intergenic
939728491 2:145753089-145753111 CAAGCATGTGACTTTAAAGAAGG + Intergenic
940564450 2:155343187-155343209 CAAGAGAATAAATTTTAAAAAGG - Intergenic
940857080 2:158737849-158737871 AAAGCAAATTAATTGAATGAAGG - Intergenic
941251137 2:163164635-163164657 AAATCTAATAAATTTAAAAAGGG - Intergenic
942523831 2:176831926-176831948 CAAGAAGATAAACTTAAAGATGG - Intergenic
942560603 2:177214413-177214435 CAAGCAAATTAATTTAAAACAGG - Intronic
942708208 2:178800880-178800902 AAAGCAAATAAAATAAAATATGG - Intronic
942745925 2:179233050-179233072 AAAGCAAAAAAATTCTAAGATGG + Intronic
942834226 2:180273986-180274008 CAAATAAATAAATTCAGAGATGG - Intergenic
943488845 2:188523622-188523644 AAACCAAATAAAGTTAGAGAAGG - Intronic
943900101 2:193422855-193422877 CAAGCAAAGAAAGGTAGAGAAGG - Intergenic
943962687 2:194286850-194286872 CAAAGAAATAAATTAAAAAATGG + Intergenic
944559908 2:200925835-200925857 ATAGTAAACAAATTTAAAGAAGG - Exonic
945104852 2:206300240-206300262 CAACCAACAAAATTTAAACAAGG - Intronic
945183879 2:207120100-207120122 CAAGGAAGTAAAGTTAGAGATGG - Intronic
945724529 2:213459627-213459649 AAAGCAAAGAAATTGAAACAAGG - Intronic
945827398 2:214740213-214740235 CCAGCAAATACATTTGAATATGG - Intronic
945856382 2:215074060-215074082 CAGGGAGAAAAATTTAAAGAAGG - Intronic
946266470 2:218546718-218546740 ACAGCATATAAATTTAAATATGG - Intronic
946598230 2:221330334-221330356 CAAACAATTCAATTTAAAAATGG + Intergenic
946956407 2:224934742-224934764 CAAGCACATTAAATTCAAGAGGG - Intronic
947539752 2:230968231-230968253 CAAGCAAATAAGGATAAATAAGG - Intergenic
948731561 2:239967068-239967090 CAAGCACATAAATCTAGAGGGGG - Intronic
1169103457 20:2973268-2973290 GAACAAAATAAATCTAAAGAAGG - Intronic
1169560330 20:6792967-6792989 CAAGGAAATAAATGTTAACAAGG + Intergenic
1169595620 20:7195070-7195092 TAACCAAATCAATTTAAATATGG - Intergenic
1169625554 20:7564469-7564491 CAAGTCAACAAATTTAAAGATGG - Intergenic
1170020971 20:11836564-11836586 CAAGCAAAGAAAGATAAGGAAGG - Intergenic
1171140501 20:22736951-22736973 CAAGCAAATAAAAAAAAAGCAGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1175512479 20:59540879-59540901 CAAGTCAATAACTTTAAAGAGGG - Intergenic
1175623514 20:60470751-60470773 TAAGCCACTAAATTTAGAGATGG + Intergenic
1177282915 21:19007865-19007887 GAATAAAAAAAATTTAAAGAAGG + Intergenic
1177606965 21:23392474-23392496 CAAGCAAAATAATGTATAGATGG - Intergenic
1177636383 21:23792415-23792437 AAAGAAAATAAATGTAAAAATGG + Intergenic
1177639766 21:23831903-23831925 CCAGCAAAAGTATTTAAAGAGGG + Intergenic
1177655149 21:24007477-24007499 CAAAAAATAAAATTTAAAGAAGG + Intergenic
1178020059 21:28397425-28397447 CAAATAAATAAATTAATAGAAGG + Intergenic
1178056629 21:28806644-28806666 CAAGAAAATAAAATTAAAAAGGG + Intergenic
1178099403 21:29251552-29251574 CAAGCAAATAAAAATAAATAAGG - Intronic
1178802974 21:35813906-35813928 AAAGGAAACAAATCTAAAGAAGG + Intronic
1178892223 21:36529781-36529803 CTAACAAATAAATATAAATAGGG - Intronic
1179197116 21:39174724-39174746 CATGAAAATAAATTTTAAAATGG - Intergenic
1179364842 21:40749384-40749406 CAAATAATTAAATTTAAAAATGG + Intronic
1179397218 21:41052063-41052085 CAACAAAATAAATTCAAATAAGG - Intergenic
1179770717 21:43613640-43613662 TTAGAAAATAAATTTAAGGAAGG - Intronic
1180578676 22:16807603-16807625 AAACTAAATAAATCTAAAGAGGG + Intronic
1181367975 22:22394056-22394078 CAGTCAAATAATTTTAAACAAGG + Intergenic
1181612240 22:24024039-24024061 CAAACAAGTCAATTTAAAAATGG - Intronic
1181904739 22:26185431-26185453 CAGGCCACTAAATTTAGAGATGG - Intronic
1182425804 22:30271461-30271483 CAAGCAATCCAATTTAAAAATGG + Intergenic
1182839984 22:33381598-33381620 CAAGCAAAAACATTTATTGAGGG - Intronic
1183097640 22:35562805-35562827 CAAACAAACAAATTTCAATAAGG + Intergenic
1183735894 22:39644665-39644687 AAAGAAAGAAAATTTAAAGAAGG - Intronic
1183764695 22:39861566-39861588 CAAACAAATAAACTTTAAAAAGG + Intronic
1184395581 22:44234848-44234870 GAATCACATAAATTTAAATATGG + Intergenic
949306300 3:2644983-2645005 AAAGAAAAAAAATTTAAAGATGG + Intronic
949420484 3:3860123-3860145 CAAAAACATAAATTCAAAGAGGG - Intronic
949542835 3:5047401-5047423 TTAGCAAATATATTTAAATAAGG - Intergenic
950362261 3:12457952-12457974 CAAATAAATAAATTTTAAAAAGG + Intergenic
951090635 3:18569447-18569469 CAAGCAAATATTTTTAAATATGG - Intergenic
951194425 3:19807889-19807911 CTGGCAAAGAAATTTTAAGACGG + Intergenic
951305149 3:21051066-21051088 CAAGCAAAACAATGTACAGAAGG + Intergenic
951517532 3:23578096-23578118 CAAGAAAAAAAATTTAAAAGTGG + Intronic
951814694 3:26741236-26741258 TAGGAAAATAAATTTAAAAAAGG - Intergenic
952470236 3:33640762-33640784 CCAGAAAATAAACTTGAAGAAGG + Intronic
952779899 3:37086035-37086057 CACACAAATCAATTTAAAAATGG + Intronic
952844790 3:37679202-37679224 CAAGCAAATTAAAATAAAAAGGG + Intronic
953206918 3:40839045-40839067 GAAACAAAAAAAATTAAAGATGG - Intergenic
953299945 3:41763453-41763475 CAAGAAAAGAAATGAAAAGAGGG + Intronic
954551299 3:51483884-51483906 CAAGCAAATAAAAGTGAAGAAGG + Intronic
954765298 3:52910186-52910208 CAAGGGAAGAAATTTAGAGAGGG - Intronic
955749147 3:62169710-62169732 CAAGCTCATAATTTTGAAGAAGG - Intronic
956018500 3:64909466-64909488 CAAGATAATAAATATAAATATGG - Intergenic
956318913 3:67973096-67973118 CAAGCAATTAATTTTTAAAAAGG + Intergenic
956478175 3:69645849-69645871 AAATAAAATAAATTTAAAAATGG - Intergenic
957108014 3:75916312-75916334 CAAGGAAATAAATTTTTTGATGG - Intronic
957222984 3:77408700-77408722 CAGACAAATAAATAAAAAGATGG - Intronic
957253546 3:77807057-77807079 CAAGCAAATAAATTTGCATAGGG + Intergenic
957920537 3:86742412-86742434 CAAGGATATAAATAAAAAGAAGG - Intergenic
958158028 3:89780247-89780269 CTAGAAAATGAATTTAAAGATGG - Intergenic
958432763 3:94061583-94061605 CACGTAAAAAAATTTGAAGAAGG - Exonic
958938485 3:100284390-100284412 TAGGCAAATAAATTAAAATAGGG - Intronic
959027134 3:101252867-101252889 ACAGAAAATAAATTTTAAGAGGG + Intronic
959055768 3:101566461-101566483 CAAGCAAATTAATCAAGAGAAGG + Intergenic
959423945 3:106162344-106162366 AAAGAAAATAAATTCAAAGTAGG - Intergenic
959494495 3:107034026-107034048 CAAGCAAATAAATAAATAAATGG + Intergenic
959698773 3:109278367-109278389 CAAGCCAAAAAAATTAAACAAGG + Intergenic
959772549 3:110117194-110117216 TAAGAAAACAAATTTAAAAATGG - Intergenic
960002787 3:112750164-112750186 CAAGAAAATTAATTTAAGCAAGG - Intronic
960304853 3:116048910-116048932 CATGCAATTAAAAATAAAGAGGG + Intronic
960483448 3:118222086-118222108 CAAGCAACTCAATTAAAAAATGG + Intergenic
960920444 3:122741467-122741489 CAAGCAAATTATTTCAGAGATGG + Intronic
961054493 3:123776436-123776458 CAAGGAAATAATATTAAATATGG + Intronic
961729008 3:128953514-128953536 CAAGAAAATAAAAAGAAAGAGGG + Intronic
961848612 3:129792008-129792030 AAATTAAAGAAATTTAAAGATGG + Intronic
962150645 3:132889593-132889615 AAAATAAATAAATTTAAAAAAGG + Intergenic
962465761 3:135657132-135657154 CCAGAAAATAAATTTAAAAATGG + Intergenic
962509257 3:136082538-136082560 CAGGCCAATAATTTTTAAGAGGG + Intronic
962846228 3:139276087-139276109 GAAACAAATATATTTAAGGATGG + Intronic
963210873 3:142688415-142688437 CACAAAAATAAATTTAAAAATGG - Intronic
963394981 3:144720395-144720417 CAAGTAACTAAATTTCAAGTAGG + Intergenic
963395176 3:144723069-144723091 ATAGCAAATAATTTTTAAGAAGG - Intergenic
963418708 3:145031505-145031527 CATACACATAAATATAAAGATGG + Intergenic
963568181 3:146958657-146958679 CTTCCAAATAAATTTAAAGAGGG - Intergenic
963637943 3:147823068-147823090 CAAGAAAATAAATGTAGATAGGG - Intergenic
963647820 3:147939093-147939115 CAAGAAAATTAAATTAAATATGG + Intergenic
963840682 3:150102757-150102779 AAAGCAACATAATTTAAAGAAGG + Intergenic
964017930 3:151970543-151970565 CAACACAACAAATTTAAAGAAGG + Intergenic
964952287 3:162310879-162310901 CCAGCCAATAAACCTAAAGACGG + Intergenic
965676021 3:171197565-171197587 CAAGCAACCCAATTTAAAAATGG + Intronic
966058110 3:175721287-175721309 CAAGCTAATATACTTCAAGAAGG + Intronic
966891084 3:184408112-184408134 CAAACAAACAAATAAAAAGAAGG - Intronic
967370035 3:188734065-188734087 TAACTAAATAAACTTAAAGAAGG - Intronic
967701704 3:192600607-192600629 CAAACAATTCAATTTAAAAATGG + Intronic
968330571 3:197865784-197865806 CAACCAATTTAATTTAAAAATGG - Intronic
969253317 4:5985139-5985161 GAAGAAAAAAAATTTAATGAAGG + Intronic
970145815 4:13034710-13034732 CAGGCACATGAATTTAAAAAAGG - Intergenic
970296098 4:14632193-14632215 AAAGCAAAATAATTGAAAGATGG + Intergenic
970706521 4:18810494-18810516 CAACCAAGTAAATTTTAAAAAGG + Intergenic
970903394 4:21186635-21186657 TAAACAAATAAACTTAAAAAGGG - Intronic
971077478 4:23166681-23166703 ACAGGAAATAAAATTAAAGAAGG - Intergenic
971175394 4:24277677-24277699 CAAGGAAATAAATGAAATGAGGG - Intergenic
971467974 4:26985541-26985563 AAAGTAAATATATTTAAAGTTGG - Intronic
971724398 4:30290920-30290942 CAAGAATATAAGTTTCAAGAGGG + Intergenic
971790537 4:31164870-31164892 AAATGAAATAAATTTAAAGTAGG + Intergenic
971966728 4:33568535-33568557 CAAGCTAAAAAATTAAAAGGTGG - Intergenic
972260469 4:37403270-37403292 CAAGAAAACAAATTTTAAAAAGG + Intronic
972464358 4:39339572-39339594 CAAACAATCAAATTTAAAAATGG - Intronic
972765001 4:42144606-42144628 TTAGCAAATAAATGAAAAGAAGG - Intronic
972804625 4:42515910-42515932 GAAGCCAATAATTTTACAGAAGG - Intronic
973669086 4:53196211-53196233 CATGAAAATAAATTGAAAGTAGG + Intronic
973912685 4:55598049-55598071 CAACAAAGTAAATTTCAAGAAGG - Intronic
973935126 4:55838379-55838401 CAAGCAAAGCAATTTAAAAATGG + Intergenic
973936073 4:55848089-55848111 CATACAAATAAATATAAGGAAGG - Intergenic
974357144 4:60827026-60827048 CAAGCAAATATAATCAAACATGG - Intergenic
974417880 4:61634426-61634448 CAAGAAAATCACTTTAATGATGG - Intronic
974657787 4:64847647-64847669 CAAGAAAACAAGTTTAAAGAAGG + Intergenic
974677871 4:65118566-65118588 GAAGAAAATACATTTCAAGATGG - Intergenic
975462666 4:74672572-74672594 CAAGGAAGAAACTTTAAAGATGG - Intergenic
975559531 4:75696055-75696077 GAAGAAAATAAATTTAAAGAAGG + Intronic
976169719 4:82290768-82290790 ACAGAAAATAAATTTAAGGAAGG + Intergenic
976198500 4:82557147-82557169 AAAGCAAATTAGTTTAAAAATGG + Intronic
976617693 4:87095106-87095128 CAAGCAAAAAAAATTAATGTGGG - Intronic
976619383 4:87112738-87112760 TAAGCAAATAAATCTGAAGTGGG + Intronic
976762449 4:88564596-88564618 CAAACAGATAAAATTAGAGATGG - Intronic
976881438 4:89930561-89930583 TAAGATTATAAATTTAAAGAAGG + Intronic
977153944 4:93549741-93549763 CAAGCAAATTAATATAATTAAGG + Intronic
977487566 4:97667647-97667669 GATGCAAATAAATGTAAGGAAGG - Intronic
977550862 4:98441760-98441782 AAAGGAAAAAATTTTAAAGATGG - Intronic
977682231 4:99809330-99809352 CAACCAAATGAAATTAAACAAGG - Intergenic
977778991 4:100957970-100957992 CAAGCAAGCCAATTAAAAGAAGG + Intergenic
978168122 4:105633264-105633286 CATGAAAATAAAGTTAATGATGG + Intronic
978175215 4:105721872-105721894 CTAGCAAATAAATTGAATGGGGG - Intronic
978253599 4:106664714-106664736 CAAGCAAAAAAATTTTAAATGGG - Intergenic
978269058 4:106865961-106865983 AAAGCAAATCAATTTAAACCTGG - Intergenic
978364265 4:107964257-107964279 CATAGAAATAAACTTAAAGAGGG + Intergenic
978524286 4:109649592-109649614 AAAGCAATTAAATTTACATAAGG - Intronic
978742864 4:112157936-112157958 TAAGCTTTTAAATTTAAAGAAGG + Intronic
978941646 4:114443609-114443631 CAAGGCGATGAATTTAAAGATGG - Intergenic
978980550 4:114940129-114940151 AAAACAAATAAATTCAAATATGG + Intronic
979188124 4:117824376-117824398 CATGCAGATAAATTGAAGGATGG - Intergenic
979360769 4:119762207-119762229 TAGGCATATAAATTTTAAGATGG + Intergenic
979459843 4:120969664-120969686 CAAGGAAAGAAATTTTAAGATGG + Intergenic
979939467 4:126741996-126742018 CATGAATATAAATTTATAGAAGG - Intergenic
980454760 4:133024443-133024465 AAAGCCAATAAAAATAAAGATGG + Intergenic
980788837 4:137591945-137591967 CAAGGAAGTAAGTTTGAAGATGG + Intergenic
981300684 4:143183086-143183108 CTATAAAATAAATTTAAAGTTGG + Intergenic
981402846 4:144334724-144334746 CAAGCAAATATAAGCAAAGACGG - Intergenic
981474200 4:145171907-145171929 CATACAAAAGAATTTAAAGAAGG + Intronic
983476862 4:168223054-168223076 AAAGCAAATTAATATAAAAAGGG + Intronic
983562974 4:169119503-169119525 CAAAAAAATAAAGTTAATGAAGG - Intronic
983733151 4:171023276-171023298 CAAGGAAATAAGATCAAAGAGGG - Intergenic
983818555 4:172164298-172164320 TAAGCAAATAATTTTAGAGATGG - Intronic
984368184 4:178825860-178825882 CAAGCAGAGAATTTTAAATAGGG + Intergenic
984975087 4:185223050-185223072 CAACCAAATAGATGTATAGATGG + Intronic
986505616 5:8447458-8447480 CAAACAAATAAAATTTAACATGG - Intergenic
986922051 5:12697428-12697450 AAAGAAATAAAATTTAAAGAGGG - Intergenic
986939172 5:12929160-12929182 GAACCAAATAAATTTACAGTAGG - Intergenic
987184532 5:15402018-15402040 TAAATAAATAAATTTAATGAAGG + Intergenic
987272252 5:16323440-16323462 GGAGAAAATAAATTTACAGATGG + Intergenic
987571842 5:19674309-19674331 AAACCAAAGAAATTTAAAAAGGG + Intronic
987691938 5:21278521-21278543 CATGCAAATAAATTTTAAGCAGG - Intergenic
987700091 5:21386398-21386420 TAAGCAAATAAAGCTAAAGGGGG + Intergenic
987974691 5:24998419-24998441 TAAGCAAATAAAATAAAACAAGG + Intergenic
988444230 5:31267361-31267383 CAAGCAAAGAACATTAAGGAAGG + Exonic
988752316 5:34201683-34201705 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
988835298 5:35026281-35026303 CAAGAGAATGAATTTAGAGAGGG + Intronic
989220533 5:38956537-38956559 TAGGCAAATAAATTAGAAGAAGG - Intronic
989428308 5:41322238-41322260 AAAGCTAATTAATTAAAAGATGG + Intronic
989744177 5:44808613-44808635 GAAGCCAATAAATTTAACCAAGG + Intergenic
990584548 5:57197657-57197679 CAAGCAAAAAAAATTGAAGCAGG - Intronic
990744700 5:58947788-58947810 CAAGAAAAAAAATCTAAAAACGG + Intergenic
990745426 5:58954514-58954536 TAAGCAAAAAAAATTAAAGCTGG - Intergenic
990760011 5:59118477-59118499 CAAACAAATTAATTTATATAAGG + Intronic
991557461 5:67911616-67911638 CAAGAAGATCAATTAAAAGAAGG - Intergenic
991740078 5:69662510-69662532 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991748448 5:69771573-69771595 CATGCAAATAAATTTTAAGCAGG + Intergenic
991757421 5:69890673-69890695 TAAGCAAATAAAGCTAAAGGGGG + Intergenic
991791653 5:70242251-70242273 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991800028 5:70351418-70351440 CATGCAAATAAATTTTAAGCAGG + Intergenic
991819541 5:70538627-70538649 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991828572 5:70658621-70658643 CATGCAAATAAATTTTAAGCAGG - Intergenic
991836824 5:70766555-70766577 TAAGCAAATAAAGCTAAAGGGGG + Intergenic
991884102 5:71242589-71242611 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991892383 5:71350849-71350871 CATGCAAATAAATTTTAAGCAGG + Intergenic
991931976 5:71762288-71762310 CAAACAGCCAAATTTAAAGACGG - Intergenic
992705085 5:79382320-79382342 CAAACAGATAAAATGAAAGAAGG + Intronic
992983505 5:82202753-82202775 CAAACAAACAAATTAAAAAATGG + Intronic
993234758 5:85290206-85290228 GAAGCAAATAATTTTAAAAAAGG + Intergenic
993371898 5:87103011-87103033 CATGCACATAAATTGAAATATGG + Intergenic
993825910 5:92686246-92686268 TAAAAAAATAAAATTAAAGAAGG + Intergenic
994128277 5:96194642-96194664 AAAGAAATTAAATTTAAAAAGGG + Intergenic
994284326 5:97946333-97946355 TAAGCAAATAAATCTTAAGGAGG - Intergenic
994638275 5:102370653-102370675 GAACCAAATAAATATAAAAATGG + Intergenic
994639883 5:102394372-102394394 AAAGCAAAACAATGTAAAGAAGG + Intronic
994679672 5:102870133-102870155 AGAGCAACAAAATTTAAAGAAGG + Intronic
994751291 5:103740126-103740148 CAAAGAAAAAAATTTAAGGATGG + Intergenic
994815415 5:104580435-104580457 CATGAAGTTAAATTTAAAGATGG + Intergenic
994853072 5:105081610-105081632 CAAATAAATAAATTTTAAAAAGG + Intergenic
995454765 5:112339423-112339445 CAAATAAATATATTTAAACAAGG + Intronic
995659759 5:114467990-114468012 CAAGCAAATCACTATAAAGGAGG + Intronic
996061261 5:119035990-119036012 AAATAAAATAAATTGAAAGAAGG - Intergenic
996294855 5:121900163-121900185 CAAACAAATTATTTTAAAGTAGG + Intergenic
996310116 5:122094968-122094990 CAAGCAAATAAATTGCAAATGGG + Intergenic
996548237 5:124703876-124703898 CATGCAAATATATCTATAGATGG - Intronic
997711025 5:136004982-136005004 AAAAAAAATAAATTTAAAGGGGG - Intergenic
997759389 5:136430474-136430496 GTAGCAGATAAAATTAAAGATGG + Intergenic
998279473 5:140791557-140791579 GAACCAGATAAATTTTAAGAGGG + Intronic
998383722 5:141743922-141743944 AAATCACATTAATTTAAAGAGGG - Intergenic
999061434 5:148639682-148639704 CTAGAATATAAATTTCAAGAGGG + Intronic
1000077289 5:157802847-157802869 CTACCAAACATATTTAAAGAGGG - Intronic
1000240406 5:159403470-159403492 CTAGGAAAGCAATTTAAAGAGGG - Intergenic
1000495423 5:161977085-161977107 CAAGCAAATAAAAATCAAGGAGG + Intergenic
1000668295 5:164026655-164026677 CAAGCAGATATATTTAAGGGAGG + Intergenic
1000695819 5:164381658-164381680 CAAGCAAAGCAATATTAAGATGG - Intergenic
1001850526 5:174960483-174960505 CAAACAACAAAATTTAAAAATGG - Intergenic
1002356615 5:178634798-178634820 CAAACAAAAAACTTTGAAGAAGG - Intergenic
1002366186 5:178713834-178713856 AAAGCAAACCCATTTAAAGAGGG + Intronic
1003702222 6:8479786-8479808 CAAGCAAAAAAAGAAAAAGAAGG - Intergenic
1003783171 6:9451943-9451965 CAAGAAAATAAAGTTCAAAATGG + Intergenic
1004133361 6:12942658-12942680 CAAATAAATAAATGTAAATAAGG + Intronic
1004696261 6:18036112-18036134 AAAATAAATAAATTTAAAGGTGG - Intergenic
1005175783 6:23042967-23042989 CTAGCTAAGACATTTAAAGAGGG - Intergenic
1005228998 6:23677475-23677497 CAAACAAATATATATTAAGATGG - Intergenic
1005267967 6:24132948-24132970 TAAGCAAATAAATGTATAGCTGG - Intronic
1005378872 6:25213792-25213814 ACAGAAAATAAATTTAAAAAAGG + Intergenic
1005491584 6:26352341-26352363 CAAGCAAAAAAATTTAATTTTGG - Intergenic
1005550481 6:26908406-26908428 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
1007540100 6:42634421-42634443 CAAACAAATAAAAATAAAAATGG - Intronic
1008074996 6:47136451-47136473 CAAGGTAATAGATTTAAGGATGG - Intergenic
1008126006 6:47669197-47669219 CAAGAAAATATTTTTAATGAAGG + Intronic
1008281029 6:49596542-49596564 TAACCAGATAAATTTAAAAAAGG + Intergenic
1008774480 6:55019937-55019959 CAAACAAATCAATTTTAAAAAGG - Intergenic
1008845161 6:55954099-55954121 CAAGAAAATAAATTTGTACAAGG - Intergenic
1009683864 6:66930905-66930927 AAAGGAAATAAATGTAAACATGG + Intergenic
1009882643 6:69588037-69588059 CAAAGAAATAAATTTAAAAATGG + Intergenic
1010100631 6:72102820-72102842 CATGCAAATCATTTTAAAAATGG - Intronic
1010764938 6:79768273-79768295 CAAGCAACACAATTTAAAAATGG + Intergenic
1010819123 6:80392626-80392648 CAAGAAAATCAATTTATAAAAGG - Intergenic
1010995586 6:82528639-82528661 TAAGCAAATAAAATTCGAGAAGG - Intergenic
1011073949 6:83417775-83417797 CAAGATAATATATTTAAATATGG - Intronic
1011432294 6:87300977-87300999 CAAGAAAATAAATGACAAGATGG + Intronic
1011442939 6:87406973-87406995 CAAGCAATTAGATCTAAGGATGG - Intergenic
1011706112 6:90003099-90003121 CGTGAAAATAAATTGAAAGAGGG - Intronic
1011755026 6:90489744-90489766 CAAACAACTTAATTTAAAAATGG - Intergenic
1011841292 6:91502705-91502727 CAGGCAATTAAATTTGAATAAGG + Intergenic
1012069543 6:94595732-94595754 CAATAAAATAATTTTAATGAAGG + Intergenic
1012742700 6:103039518-103039540 AAAATAAATAAATTTAAAAAGGG - Intergenic
1013066785 6:106691920-106691942 AATGCAAGTAAATTAAAAGAAGG + Intergenic
1013140373 6:107327771-107327793 CAATATAATATATTTAAAGAAGG - Intronic
1013147159 6:107404938-107404960 CAAGCAAATACATTGCAAGAAGG + Intronic
1013954779 6:115828630-115828652 TAAGAAAATAATTTTAAATATGG - Intergenic
1014358637 6:120445780-120445802 ATAGAAAATAATTTTAAAGATGG - Intergenic
1014868171 6:126557769-126557791 CAAGCAAACAAATACAAAAATGG - Intergenic
1014903282 6:126995177-126995199 CAAGCAACCCAATTTAAAAATGG + Intergenic
1015010918 6:128346297-128346319 AAAGAAGGTAAATTTAAAGAAGG + Intronic
1015141353 6:129936978-129937000 CAACCAACTACATTTAAAAATGG + Intergenic
1015840259 6:137468903-137468925 TAAACAAATCATTTTAAAGATGG + Intergenic
1017147455 6:151247552-151247574 CAAGCAAATAAATTTAAAGATGG - Intronic
1017305568 6:152914556-152914578 AAAGCAAATAAATTTATCCAAGG - Intergenic
1017358637 6:153540762-153540784 CAAACAACTCAATTTAAAAATGG - Intergenic
1017579262 6:155844093-155844115 CAAGAAAACAAATTAAAAAATGG + Intergenic
1017795509 6:157840610-157840632 CAATCAATTAAGTTTTAAGAAGG - Intronic
1018322829 6:162631521-162631543 CAATAAAAAAAATTTAAAAATGG - Intronic
1018522040 6:164660139-164660161 CAAGAAAAAAAATGTAAAGAAGG - Intergenic
1019880508 7:3856304-3856326 CAAGAAAATATATGAAAAGAGGG + Intronic
1020442543 7:8233787-8233809 CAATAAAATAAATTTAAAATTGG + Intronic
1020657279 7:10942557-10942579 TCAGCAAATAAATTAGAAGAAGG + Intergenic
1020717706 7:11697175-11697197 TAATCAATTAAATTTAAACATGG - Intronic
1020928365 7:14360695-14360717 CAAGCAAATATTATTAAACAGGG - Intronic
1020953931 7:14715724-14715746 CAAGCAAAACAATGTACAGAGGG + Intronic
1021249034 7:18301311-18301333 GGAGCAAATTAATTTAAATATGG + Intronic
1021289424 7:18824378-18824400 CAAGGAAGTAAATTTAATGATGG + Intronic
1021426445 7:20504838-20504860 CAAGAAAATAAATAAAAATATGG + Intergenic
1021477490 7:21079191-21079213 CAAAGAAATAAACTTAGAGATGG + Intergenic
1021741737 7:23693116-23693138 CAGGCAGACAAATTCAAAGATGG - Intronic
1022575541 7:31493475-31493497 CAAGCAAATAAATAAGAAGAGGG - Intergenic
1022872965 7:34498674-34498696 CAGGGAAATATATTTTAAGATGG - Intergenic
1023462153 7:40410233-40410255 AAACTAAATAAAATTAAAGAAGG - Intronic
1023909531 7:44543418-44543440 TAAGGAAATAAATTCAAAGAAGG - Intergenic
1024026381 7:45413402-45413424 CAAGCAAATACATTTGGACATGG + Intergenic
1024236697 7:47404002-47404024 CAGGTAAATAAAGTTAAAGCCGG - Intronic
1024366932 7:48531254-48531276 CAAACAAAAAAACATAAAGATGG - Intronic
1024426100 7:49228229-49228251 CAAGAAAGTAACTTTAAAAATGG - Intergenic
1024576044 7:50764983-50765005 CAAGTAACTCAATTTAAAAATGG + Intronic
1024681335 7:51692743-51692765 CAAACAAATAAATAAAATGAGGG - Intergenic
1024752234 7:52480844-52480866 TATGCAAATAATTTTAAAAATGG - Intergenic
1024931472 7:54668856-54668878 AAAGCAAATAAAATTAAGGTAGG + Intergenic
1025523436 7:61772152-61772174 CAAACAGATAAATCAAAAGAAGG + Intergenic
1025753747 7:64314568-64314590 AAAATAAATAAATTTAAAAAAGG - Intronic
1026368192 7:69671147-69671169 CAAGCAAATCAAGTAAAAAATGG - Intronic
1026398671 7:69986137-69986159 TAAGCAAATACATTTACAAAGGG - Intronic
1026588026 7:71673196-71673218 CAAGCAAATAATCTGAAATAAGG + Intronic
1026609279 7:71843183-71843205 ATAGGAAAGAAATTTAAAGAGGG - Intronic
1026721181 7:72831980-72832002 TAAACAAAAAAATTTAGAGATGG - Intergenic
1026793274 7:73349104-73349126 CAAAAAAAAAAATTTAAAAAGGG + Intronic
1026836423 7:73642655-73642677 AAAATAAATAAATTTAAAAAAGG - Intergenic
1027358814 7:77386698-77386720 AAAGCACAAAAATTGAAAGATGG + Intronic
1027401897 7:77817776-77817798 CAAACAATCCAATTTAAAGATGG - Intronic
1027622125 7:80501515-80501537 CAATCAGATAAATTTGAATATGG - Intronic
1027813937 7:82944579-82944601 CAAAAAAATAAATTCAAAAATGG + Intronic
1027958153 7:84909186-84909208 CTATTAAATAAATTAAAAGAAGG + Intergenic
1028010805 7:85641352-85641374 CAAACATATGAATTTAAAAATGG + Intergenic
1028568013 7:92254592-92254614 CCAACAAATATATTGAAAGATGG - Intronic
1028847150 7:95494540-95494562 CAACAAAATAAATTTTAACATGG - Intronic
1028919458 7:96294897-96294919 AAAGCAAATGAATTAAAAGCAGG - Intronic
1028960110 7:96739082-96739104 CCAACAAATAAATTTAAAATGGG - Intergenic
1030282116 7:107787577-107787599 CAAACAAATAAAAATAAACATGG + Intronic
1030306347 7:108022356-108022378 TAAGAAAATAATCTTAAAGATGG - Intergenic
1030525833 7:110653908-110653930 CAAGAAAATAAAATTAATGTTGG + Intergenic
1030548310 7:110926955-110926977 CAAGGAATTATATTGAAAGAGGG - Intronic
1030839322 7:114328663-114328685 CAAGCAAATAAAAATATATAAGG + Intronic
1031138744 7:117917903-117917925 GAAGCAAATAAAACAAAAGATGG - Intergenic
1031225041 7:119025314-119025336 TAAAAAAATAAATTTAAAAAAGG - Intergenic
1031409069 7:121420821-121420843 CAAGCAAATACAAACAAAGAAGG - Intergenic
1031530686 7:122872805-122872827 CCAGAAAAAAAATTTAAATAGGG + Intronic
1031737327 7:125382755-125382777 CAATGACATAAAATTAAAGATGG - Intergenic
1031779558 7:125944444-125944466 AAAGCAACTCAATTTAAAAATGG + Intergenic
1032224877 7:130023374-130023396 CATGTGAATAAATTTAAAGTTGG - Intronic
1032593851 7:133219257-133219279 CAATTAAACAAATTTTAAGAGGG - Intergenic
1032594082 7:133222028-133222050 CAAGAAAATAAATATAATTATGG - Intergenic
1032817913 7:135496057-135496079 CAAGAAAATAACTGTAAAAATGG - Intronic
1033008946 7:137598310-137598332 AAAACTAATAAATATAAAGAGGG - Intronic
1033851624 7:145503384-145503406 GAAGCAAATACTATTAAAGATGG + Intergenic
1035752278 8:2004463-2004485 CAAACAAATAATATTAAAGTAGG - Exonic
1036099625 8:5764802-5764824 CAAGCAACCTAATTTAAAAATGG + Intergenic
1036137813 8:6178341-6178363 CAAGCAAATAAGCGGAAAGAGGG - Intergenic
1036571767 8:9985927-9985949 TAAACAAAAAATTTTAAAGACGG + Intergenic
1037340831 8:17842891-17842913 CAAACAACTGAATTTTAAGATGG + Intergenic
1037592062 8:20321378-20321400 CAAGCAAGTGAATTTGATGATGG - Intergenic
1038274761 8:26111970-26111992 CAAGCAACTCAATTTAAAAATGG + Intergenic
1038979673 8:32745231-32745253 CAAACAATTAAATTTTAAAACGG - Intronic
1039020477 8:33199146-33199168 CAATCAGATAAATTTGAACATGG + Intergenic
1039090492 8:33823535-33823557 TAAACAACTAAATTTAAAGATGG + Intergenic
1039161009 8:34620043-34620065 CAAGTAAATAAAATTATAAATGG - Intergenic
1039459232 8:37729465-37729487 TAAGTAAATAAAATAAAAGAGGG + Intergenic
1039644131 8:39261880-39261902 CAAACAATTAGATTTAAAAATGG - Intronic
1039678311 8:39698251-39698273 AAAGTAAAGAAATTTAAAAATGG - Intronic
1040405201 8:47094890-47094912 TAAATAAATAAATTTAAACAGGG + Intergenic
1041522264 8:58769612-58769634 CAAGCAATTAAGGTTAAATAAGG - Intergenic
1042085549 8:65104751-65104773 AAAGCAAATAGATTGAAAGCAGG + Intergenic
1042157605 8:65862824-65862846 CAAGAAAATAACTTCAAAGGTGG + Intergenic
1042617540 8:70666763-70666785 GAAGCAAATAAATGTCAGGAAGG + Intronic
1043004393 8:74800165-74800187 TAAGCTAATAAATTTGAAGCTGG - Intronic
1043037483 8:75216382-75216404 AAATCAAATAAATTGAAAAATGG + Intergenic
1043195202 8:77284388-77284410 CATGCATAGAAATTAAAAGAAGG - Intergenic
1043233899 8:77836349-77836371 CAGGCAAAGAAAATGAAAGAGGG + Intergenic
1043505952 8:80902896-80902918 CAAGTACTTCAATTTAAAGATGG + Intergenic
1043551743 8:81381200-81381222 CAAGCATACAAATTGATAGAAGG - Intergenic
1043932542 8:86107260-86107282 AAAACAAATGAATTTAAAAAGGG + Intronic
1044133219 8:88552494-88552516 CAGGCAAATAAATTAAACAAAGG + Intergenic
1044271179 8:90245945-90245967 TAAGTAAATAAATTTTAATAAGG + Intergenic
1044443791 8:92250145-92250167 AAAGCAAATAAATCTCAATAAGG - Intergenic
1044588180 8:93887474-93887496 CAAGCTAATATTTTTAAATACGG - Intronic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1045057285 8:98380299-98380321 CAATAAAATAAATTTTAAAAAGG + Intergenic
1045434124 8:102142725-102142747 CAATCATATAAAATAAAAGAAGG - Intergenic
1045523589 8:102924348-102924370 ATTTCAAATAAATTTAAAGAGGG + Intronic
1045795134 8:106034300-106034322 AAAGAAAATACATTTAAAAATGG + Intergenic
1045916607 8:107479274-107479296 CAAGGAAATAATTTAACAGAAGG - Intronic
1045988010 8:108272726-108272748 TAAGAAAATAGATTTAATGAGGG + Intronic
1046377030 8:113397229-113397251 GAAAAAAACAAATTTAAAGATGG - Intronic
1046521593 8:115332561-115332583 CTAGAAAATAAAATTAAAAATGG + Intergenic
1046659145 8:116929984-116930006 CAATCAAATTAATGTAAAAAAGG + Intergenic
1046677496 8:117126730-117126752 GAAACAAACAAAATTAAAGATGG + Intronic
1046976806 8:120287717-120287739 CAAGGAAAAAAATTCAAAAAAGG + Intronic
1047094457 8:121609105-121609127 AAAACAAGTAAATTTGAAGATGG - Intergenic
1047182362 8:122601711-122601733 CAAGAAAATAATCTGAAAGAAGG - Intergenic
1047830936 8:128628759-128628781 CAATCAAGTAAACTTAGAGAAGG - Intergenic
1048406023 8:134122692-134122714 CAATCAAATAATTTTCAATAGGG + Intergenic
1049699382 8:144001854-144001876 CACGTATATATATTTAAAGATGG - Intronic
1049866056 8:144937000-144937022 CAAGCAACCCAATTTAAAAATGG - Intronic
1051075745 9:13233019-13233041 GGAGAAAATAAATTTAAAGTGGG + Intronic
1051572471 9:18575606-18575628 AAAGCAAATAGATTTAGAAAGGG + Intronic
1051886680 9:21900326-21900348 CAAGGAAAAAAATTTAAAAATGG + Intronic
1052389619 9:27863946-27863968 CAAGGAAATGAAGTGAAAGATGG + Intergenic
1052759330 9:32573473-32573495 CAAGCAAATAATTTTGAATCTGG - Intergenic
1053386017 9:37689876-37689898 CAAACAAATGAAATTAAAAATGG - Intronic
1053753920 9:41283789-41283811 CAAATAAATAAATTGAAAAAAGG - Intergenic
1054259440 9:62848150-62848172 CAAATAAATAAATTGAAAAAAGG - Intergenic
1054332336 9:63771887-63771909 CAAATAAATAAATTGAAAAAAGG + Intergenic
1054991718 9:71335401-71335423 CAAGTCATTAAGTTTAAAGATGG - Intronic
1056172342 9:83997965-83997987 TAAAAAAAAAAATTTAAAGATGG + Intronic
1057010192 9:91594203-91594225 CAAAAAAATAAAGTAAAAGAAGG - Intronic
1057233751 9:93342344-93342366 CAAGCAATGAAAATTAAAGGTGG - Intronic
1057269352 9:93640095-93640117 CAAGCAACTATCTTGAAAGAAGG - Intronic
1057913466 9:99037672-99037694 CAGGCAAATGAACATAAAGAGGG + Intronic
1057984266 9:99694311-99694333 CAAGGCAATACAATTAAAGATGG + Intergenic
1058054180 9:100433254-100433276 AATATAAATAAATTTAAAGAAGG - Intronic
1058324082 9:103673514-103673536 CAACAAAATAAAAATAAAGATGG + Intergenic
1058413539 9:104762030-104762052 CAAACAAATCAATTTAAGAATGG + Intergenic
1059185606 9:112267450-112267472 AAAGTAAATACATTTTAAGAAGG - Intronic
1059519227 9:114924377-114924399 CAAGTAAAGAAATTAAAATATGG + Intronic
1059558245 9:115304436-115304458 CAATAAAATAAAGTTACAGATGG - Intronic
1059821227 9:117974474-117974496 CAAGCACATCATTTTAAAGGAGG - Intergenic
1060079647 9:120630823-120630845 TAAACAAATAATTTTAAAAATGG - Intronic
1060083571 9:120675986-120676008 CAACTAAAGAAATGTAAAGAAGG - Intronic
1060632646 9:125173615-125173637 CAAAAAAATAAAATTAAAAAAGG - Intronic
1060703021 9:125775945-125775967 TAAACAAATAAATTTAACCAGGG - Intronic
1185479464 X:435222-435244 GAAGAAAATAACTTTAAAAATGG + Intergenic
1185988538 X:4865878-4865900 AAAGAAAATAAATTTGGAGAAGG - Intergenic
1186372038 X:8956614-8956636 CAAACAAAAAAACTTTAAGATGG + Intergenic
1186719133 X:12284097-12284119 CAAACAAAAAGCTTTAAAGAGGG - Intronic
1186741172 X:12519716-12519738 CAAACAACTCAATTTAAAAATGG + Intronic
1186863620 X:13697025-13697047 TAAGAAGATATATTTAAAGAGGG - Intronic
1187758330 X:22550108-22550130 CTATCAAATAAAATTAAATAGGG - Intergenic
1187775664 X:22753892-22753914 CAAGCAAGGAGATTGAAAGAGGG + Intergenic
1188122807 X:26330373-26330395 CATGCAAATAAAGTTAAAGCTGG - Intergenic
1188128657 X:26402754-26402776 CAAGCAAATTACTTTAAATATGG + Intergenic
1188143748 X:26584938-26584960 CAAGAAAATATATTGCAAGAAGG - Intergenic
1188740941 X:33780795-33780817 CAAGGTGATAAATCTAAAGAGGG - Intergenic
1188809107 X:34630600-34630622 AAAGCCAAAAATTTTAAAGATGG + Intronic
1188929900 X:36095349-36095371 AAAGCAAAGAAATATAAAAAAGG - Intronic
1188953038 X:36400193-36400215 GAATTAAATAAATGTAAAGATGG - Intergenic
1189613115 X:42757940-42757962 CAAACAAAGAAATTTTTAGATGG - Intergenic
1189760484 X:44316790-44316812 CAAACAATTGAATTTAAAAATGG + Intronic
1189844819 X:45125441-45125463 CAAATAAATAAAATTAAAGATGG - Intergenic
1189964670 X:46360421-46360443 CTAGAAAACAAATTTAAAAATGG - Intergenic
1190439050 X:50458577-50458599 CATACAAATAAATTGAAAGCTGG + Intronic
1190585418 X:51935181-51935203 CAAGCAAAAAAAATTTAAGATGG - Intergenic
1190724914 X:53182675-53182697 CAAGCAATTCAATTTAAAAATGG - Intergenic
1190960175 X:55239118-55239140 TAAGTAAATAAATTTTTAGAAGG + Intronic
1191684598 X:63877027-63877049 CAAACAATCAAATTTAAAAATGG + Intergenic
1191730441 X:64328918-64328940 CAAGCCAAAAAATTAAAAGCAGG + Intronic
1192255696 X:69455708-69455730 CAAGCAATCCAATTTAATGATGG - Intergenic
1192633713 X:72797624-72797646 CAAGCAAATAAATGAAGAGGAGG - Intronic
1192647997 X:72923177-72923199 CAAGCAAATAAATGAAGAGGAGG + Intronic
1192757081 X:74057732-74057754 GAAATAAATAAATTTAAAAAGGG + Intergenic
1192816732 X:74601539-74601561 GAAGCAAATAAGGTTAAATAAGG - Intronic
1193322899 X:80144809-80144831 CAAGTAGACAAATTTAAATAAGG + Intergenic
1193487608 X:82106052-82106074 CAAGTAAATACATTACAAGAAGG - Intergenic
1193524349 X:82571586-82571608 CTATCAAATAAATTTAACAAAGG - Intergenic
1193550587 X:82887797-82887819 AAAACAAACAAATTTAAAAATGG + Intergenic
1193634497 X:83931442-83931464 GTAGTAAATAATTTTAAAGATGG + Intergenic
1194019013 X:88664207-88664229 CAAACAACTCAATTTAAAAATGG - Intergenic
1194019709 X:88672091-88672113 TAAGCAAATAAATTAGAAGATGG - Intergenic
1194414913 X:93599679-93599701 CATGACAATAAATTCAAAGAAGG + Intergenic
1194551442 X:95305770-95305792 CTTGCAAATAAATTTAAACAAGG + Intergenic
1194551646 X:95308319-95308341 AAAGAAAATAAATTTAAAATAGG + Intergenic
1194767827 X:97863088-97863110 CAATAAAAAAAATTTAAGGATGG + Intergenic
1194858446 X:98963702-98963724 CAAATAAATACATTTAAACAGGG - Intergenic
1195046034 X:101055419-101055441 CAGGCAAATTCATTTAAAGCAGG + Intergenic
1196336389 X:114541249-114541271 CAAGTAATCAAATTTAAAAAGGG + Intergenic
1196591206 X:117487208-117487230 CAAGCAGATTAAGTTAAACAAGG + Intergenic
1196873136 X:120131452-120131474 CATGCAGATGAATTGAAAGATGG + Intergenic
1198965651 X:142227028-142227050 AAAGCAAATAAATAAAAAAATGG + Intergenic
1198967899 X:142246423-142246445 CATCGAAATACATTTAAAGAAGG + Intergenic
1199158511 X:144579141-144579163 CAATAAAGTGAATTTAAAGATGG - Intergenic
1199335003 X:146608914-146608936 TAAGCAAAAAAATTTAATAAGGG + Intergenic
1199627554 X:149754619-149754641 TAAGCTAATAAATTAAGAGATGG - Intergenic
1199655247 X:149988133-149988155 TAAGCAAATAATTTTTAAAAAGG - Intergenic
1199901003 X:152172119-152172141 CAAACAACTCAATTTAAAAATGG + Intronic
1199922966 X:152429144-152429166 GTAGGAAATAAATTTAAAGAAGG + Intronic
1200353441 X:155523183-155523205 CAAGCAATACAATTTAAAAATGG - Intronic
1200751530 Y:6949139-6949161 CATGCAAAACAATTTACAGATGG - Intronic
1200834011 Y:7715245-7715267 CAAACAAATAAAAAAAAAGATGG - Intergenic
1201017244 Y:9618298-9618320 CATGCACATAAATGTTAAGATGG - Intergenic
1201672471 Y:16539512-16539534 CAAACAAATATATTAAAAAATGG - Intergenic
1202597308 Y:26554348-26554370 CAAGAACAGAAATTAAAAGATGG - Intergenic