ID: 1017148016

View in Genome Browser
Species Human (GRCh38)
Location 6:151252148-151252170
Sequence GGCTTTTGGAGTATTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017148010_1017148016 0 Left 1017148010 6:151252125-151252147 CCACTGGCATTGGAGGCCATCGA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1017148016 6:151252148-151252170 GGCTTTTGGAGTATTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017148016 Original CRISPR GGCTTTTGGAGTATTGGGCA AGG Intronic
No off target data available for this crispr