ID: 1017152076

View in Genome Browser
Species Human (GRCh38)
Location 6:151289787-151289809
Sequence CTTTGTAAAGGGAGGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017152076 Original CRISPR CTTTGTAAAGGGAGGGTGGT GGG Intronic
900620411 1:3584474-3584496 CTTTGGAGAGCCAGGGTGGTGGG - Intronic
900988701 1:6087622-6087644 CCTTGAGAAGGGAGAGTGGTCGG + Intronic
902955889 1:19923840-19923862 TTTTGGAAAGGGTGGGTGATGGG - Intergenic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
905161805 1:36042499-36042521 CTTGGTAAAGTGAAGCTGGTTGG + Intronic
905686345 1:39911461-39911483 ATTTCTAAAGGCAGGATGGTAGG - Intergenic
906544203 1:46609967-46609989 CCTTGGTAGGGGAGGGTGGTAGG + Intronic
906806005 1:48779453-48779475 CCTTGAAAAGTGTGGGTGGTTGG - Intronic
907853703 1:58280972-58280994 CTTTGTACATGGATGGAGGTTGG + Intronic
909044132 1:70688916-70688938 CTTTCTAATGTGAGGGTAGTTGG + Intergenic
909784394 1:79592917-79592939 CTTTTTAAAAGCAGGGTGGGAGG - Intergenic
909822770 1:80086923-80086945 CTTTGAAAAGGGAGGGGTTTGGG - Intergenic
910861000 1:91742259-91742281 CTTTGTCAAATGAGGGTGGCAGG - Intronic
911422365 1:97659996-97660018 CTCTGTAATGGCATGGTGGTTGG + Intronic
915079662 1:153343410-153343432 CTCTGAAAAGGGAAGGGGGTAGG - Intronic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
918129816 1:181617418-181617440 CTTTGTCAAGGGTGGAAGGTGGG + Intronic
919361193 1:196596985-196597007 CTTTGTAAGGGCTGGGTGGGTGG - Intronic
919776322 1:201196252-201196274 CTTTCTAAAGCCAAGGTGGTGGG - Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920426551 1:205881493-205881515 TTTTGTATAGGGTGAGTGGTGGG + Intergenic
920693774 1:208166069-208166091 CTTTGTAAAGGTGGGGTGGTGGG - Intronic
921284334 1:213595482-213595504 CTTTGCAAAGGAAACGTGGTTGG - Intergenic
921522627 1:216175804-216175826 CTTGGTAGAGGGACTGTGGTTGG - Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
921825071 1:219663346-219663368 CTTTTTAAAGGGGTGGTGGCTGG - Intergenic
923333220 1:232945045-232945067 CTTTGTAAAGAGAGGTTGACAGG + Intergenic
924844512 1:247752017-247752039 TTTTGTAAAGGGAAAGAGGTGGG + Intergenic
924937435 1:248784041-248784063 CTTAGTAAAGGGCTGGGGGTGGG - Intergenic
1063493302 10:6484960-6484982 CTTTGTAAAAGGCAGGAGGTGGG - Intronic
1064440035 10:15345508-15345530 CTGTATAAAGGCAGGGTGGCCGG + Intronic
1065918226 10:30369504-30369526 CTTTGTAGAGGGAGGGATGTGGG - Intronic
1065931960 10:30487838-30487860 CTTTGGAAAGGAAAGGTGGCAGG - Intergenic
1066550021 10:36545815-36545837 CTCTGTAAAAGGAGGGAGCTAGG - Intergenic
1068799705 10:61126522-61126544 CTCTATAAATGGAAGGTGGTAGG - Intergenic
1069305208 10:66960804-66960826 CTTAGAAAAGGGGGGATGGTAGG + Intronic
1069356687 10:67594877-67594899 CATTGGAAAGGGTGGGAGGTGGG - Intronic
1070486507 10:76937059-76937081 CTTTGTGATGGGAGGGAGATTGG - Intronic
1070592880 10:77812870-77812892 CTTTGTAAAGGGAGAAGGCTGGG + Intronic
1074483742 10:113853642-113853664 CTTTGTCCAGGGACTGTGGTTGG - Exonic
1074500564 10:114019942-114019964 CTGTGTTAAGGCAGGGTGCTAGG - Intergenic
1075877676 10:125822090-125822112 CTCTGTAAAATGAGGGGGGTGGG - Intronic
1076734014 10:132450788-132450810 CTTCGTGAAGGGAGAGTGGGGGG + Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1077294278 11:1817448-1817470 CTTTTTGAAGGGAGTTTGGTGGG - Intergenic
1077964307 11:7111498-7111520 CTGTGAAGAGGGAGGGTCGTAGG - Intergenic
1078336362 11:10466345-10466367 CTTCGTAGGGGGAGGGTCGTTGG + Intronic
1079202667 11:18388847-18388869 CTATGTAAAGGGACTGTGCTAGG - Intergenic
1080935119 11:36855101-36855123 CTATGTGCAGGGAGGGTGGGAGG + Intergenic
1082736229 11:56859070-56859092 CTTTTAAAAAGCAGGGTGGTTGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1083332862 11:61907088-61907110 CTTTGTAAAGTGGGGCTGGGAGG + Intronic
1084491649 11:69481817-69481839 CTTTAAATAGGGAGGGAGGTGGG + Intergenic
1084500975 11:69534988-69535010 AGATGTAAAGGGAGAGTGGTGGG + Intergenic
1084873660 11:72114949-72114971 CCATGTAAAGAAAGGGTGGTAGG + Intronic
1085568793 11:77541008-77541030 CTCTGTGAAAGTAGGGTGGTTGG + Intronic
1087363604 11:97192101-97192123 CTCTGAAAAGGGTGGGTGGGAGG - Intergenic
1088611018 11:111577137-111577159 TTTTGTAAAAGGAGGGTTGCCGG - Intergenic
1089704922 11:120271156-120271178 AGGTGTAAAGGGAGGGTAGTTGG - Intronic
1089865902 11:121631444-121631466 CTTATTAAAGGGGAGGTGGTAGG - Exonic
1092132853 12:6124632-6124654 GGTGGGAAAGGGAGGGTGGTTGG - Exonic
1093756534 12:22859227-22859249 CTCTGTAAAGGTAGCGAGGTGGG + Intergenic
1094586286 12:31780680-31780702 CTTTATAAAGGCAGGGAGGAAGG - Intergenic
1094649791 12:32364412-32364434 CTTTGTAAAATGAAGGAGGTAGG - Intronic
1095466702 12:42495123-42495145 CTTTGGAAAGTTAGGGTGGGTGG + Intronic
1095732018 12:45516419-45516441 CATTATAAAGGGAGTGGGGTGGG - Intergenic
1098403591 12:70100010-70100032 ATTAGTAAATGGAGGGTGGATGG - Intergenic
1098575366 12:72035907-72035929 CTGTGGAAAGGGAGTGTAGTGGG + Intronic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101034182 12:100688640-100688662 CTTTGTAAAGTGCGGATGGTGGG + Intergenic
1101719155 12:107336005-107336027 CTTTGCATTGGGCGGGTGGTGGG - Intronic
1102657612 12:114495821-114495843 CTTTGTAAGTGGAGACTGGTGGG + Intergenic
1103518764 12:121524142-121524164 CTTTCTGCAGGGAGGGAGGTAGG - Intronic
1105634482 13:22204061-22204083 GATTGTGAAGGGAGGGTGTTGGG + Intergenic
1105772013 13:23620917-23620939 CTTTGTTAAGAGGGGGTGGTAGG - Intronic
1105841763 13:24259881-24259903 CTTTGTAAAGCCAAGGTGGGAGG - Intronic
1106654214 13:31725207-31725229 CCTTTTAAAGGGAGGTTTGTAGG - Intergenic
1106727735 13:32503475-32503497 CTTTATGAAGGGAAGATGGTGGG - Intronic
1107418232 13:40221165-40221187 ATTTGAAAAGGGACAGTGGTGGG - Intergenic
1108538507 13:51412136-51412158 AGTTGTCAAGGGAGGGTGATAGG + Intronic
1109390431 13:61684895-61684917 CTTCTTCATGGGAGGGTGGTGGG - Intergenic
1110492809 13:76128774-76128796 CTTTGCATAGGGTAGGTGGTAGG + Intergenic
1111153627 13:84293557-84293579 ATTTGTAATGTGAGGGTGCTAGG + Intergenic
1111889696 13:94066795-94066817 CCTTATAAAGGGAAAGTGGTTGG - Intronic
1113239113 13:108316487-108316509 CATTGTAAAGGGAGGCTGTGGGG - Intergenic
1113468708 13:110530118-110530140 CTGTGTAGAGGTGGGGTGGTGGG - Intronic
1113468725 13:110530165-110530187 CTGTGTAGAGGTGGGGTGGTGGG - Intronic
1114633506 14:24174225-24174247 CTTTGGAAAGCCAGGGTGGGTGG - Intronic
1115395126 14:32900199-32900221 CTTGATAAAGAGAGGGTGTTGGG - Intergenic
1115618571 14:35119654-35119676 CTTTTTAAAAGGTGGGTGGTCGG - Intronic
1120352576 14:83381713-83381735 CTTTGGTAAGGCAGGGTGCTTGG + Intergenic
1120398361 14:83996653-83996675 ATTTGTAGAGGGAAGGTGTTAGG + Intergenic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1121856047 14:97271036-97271058 CTTTATAAAGAGAGGATGGATGG - Intergenic
1122230668 14:100305148-100305170 CGTTGAAAAGGGAGTGTGTTGGG - Intronic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122522050 14:102351639-102351661 CAATGTAATTGGAGGGTGGTTGG - Intronic
1123465486 15:20511730-20511752 CTCTGTGAAGGGAGCTTGGTGGG - Intergenic
1123652630 15:22489307-22489329 CTCTGTGAAGGGAGCTTGGTGGG + Intergenic
1123743054 15:23298166-23298188 CTCTGTGAAGGGAGCTTGGTGGG + Intergenic
1123980627 15:25598886-25598908 CTCTGTAAAGGGAGGGTTTGGGG + Intergenic
1124276208 15:28327709-28327731 CTCTGTGAAGGGAGCTTGGTGGG - Intergenic
1124306490 15:28583898-28583920 CTCTGTGAAGGGAGCTTGGTGGG + Intergenic
1125511312 15:40293945-40293967 CTTTGGCTAGGGAGGGAGGTGGG - Intronic
1126062016 15:44791991-44792013 CTCTGTACAGGGAGAGTGGCTGG + Intergenic
1128134925 15:65255687-65255709 CTTTTTGCAGGGAGGGGGGTTGG + Intronic
1128725617 15:69986532-69986554 CCTAGGAAAAGGAGGGTGGTGGG + Intergenic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1133317317 16:4892755-4892777 CTTTGTATAGGAAAGGAGGTGGG + Intronic
1135227748 16:20676049-20676071 CTTGGTAAAGGGAGGTAGATTGG - Intronic
1135795898 16:25442224-25442246 CTTTGTAAAAGGGGTGTGTTGGG + Intergenic
1136008430 16:27346855-27346877 CTCTGTAAAGGTAGGGCTGTGGG + Intronic
1138360988 16:56426722-56426744 CTTTGTGAAGGCAAGGTGGGAGG - Intergenic
1140245572 16:73245057-73245079 CTCTGTGAAGGGAGGATGGGTGG + Intergenic
1140783673 16:78319157-78319179 CTTTGAAAATGGAGGGAGGCGGG + Intronic
1142832809 17:2561919-2561941 CGTTGTGAAAGGAGGATGGTTGG + Intergenic
1144666354 17:17104927-17104949 CTTGGTTTAGGGAGGGTGGTTGG + Intronic
1144965856 17:19076926-19076948 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1144982112 17:19175256-19175278 CTTGGTCAGGGGAGGATGGTCGG - Intergenic
1144986111 17:19202983-19203005 CTTGGTCAGGGGAGGATGGTCGG + Intergenic
1147286568 17:39407203-39407225 CTTAAGAAAGGGAGGGGGGTGGG - Exonic
1148131860 17:45266960-45266982 GTGGGTAAAGGGAGGGTGATGGG - Intronic
1148805069 17:50259815-50259837 CTTGGCAAAGGGAGCGGGGTGGG + Intergenic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1150633851 17:66898929-66898951 CTTGGGAAAGGAAGGGTGGGAGG - Intergenic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151810345 17:76436676-76436698 CTTTGTAAAGAGAGGCAGTTTGG - Intronic
1152174126 17:78775466-78775488 CTCTGTAGAGGAAGAGTGGTGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1153109969 18:1574279-1574301 GTTTTTAAAGGCAGGGAGGTTGG - Intergenic
1153506944 18:5810477-5810499 ATTTATTTAGGGAGGGTGGTGGG - Intergenic
1154316877 18:13311274-13311296 CTTTGTCAGGGGTGGATGGTGGG + Intronic
1156029735 18:32698583-32698605 CTTTTTAAATGGAGGGAAGTGGG - Intronic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156600839 18:38604178-38604200 CTGTGTAAAGGGATGAGGGTGGG + Intergenic
1157392182 18:47312029-47312051 CATTGGAAAGTGAGGGAGGTTGG + Intergenic
1159390707 18:67788913-67788935 CTTAGCAAAGGCAGAGTGGTTGG + Intergenic
1159665296 18:71151535-71151557 CTTTCTAAGAGGAGGGTGATAGG + Intergenic
1160503643 18:79415177-79415199 CTTTGTAGAGGCAAGGTTGTAGG + Intronic
1161731868 19:5965550-5965572 CTTGGGACAGGGTGGGTGGTGGG + Intronic
1164533780 19:29068795-29068817 CTTTGTCAAGTGGGGGTGGGGGG - Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1167316048 19:48763328-48763350 CTTTGTAAGGCCAGGGTGGGCGG + Intergenic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167991428 19:53364571-53364593 CTTTGTGAGGGGAGTGTGGCAGG - Intergenic
1168123025 19:54265190-54265212 TTTGGTGAAGAGAGGGTGGTTGG - Intronic
1168642492 19:58039469-58039491 CTTTGATAAGGGTGGGTGGCCGG - Intronic
925591875 2:5517857-5517879 CATTGTCAAGAGAGGGTAGTGGG - Intergenic
926004470 2:9362272-9362294 CCTTGTGAAAGGAGAGTGGTGGG + Intronic
926927873 2:18006286-18006308 GTATGTAAAAAGAGGGTGGTGGG + Intronic
927319043 2:21721187-21721209 TTTTGTAAAGGGATGGTGAGTGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
929576656 2:43056578-43056600 CTTGGTAAGGGGAGAGTGGCTGG + Intergenic
930544143 2:52745816-52745838 CTCTGTAAAGGCAGTGTGGAAGG + Intergenic
930794590 2:55375138-55375160 CTTTGGAAAGCCAGGGTGGGAGG + Intronic
931169067 2:59783444-59783466 CTTTATAAAAGTAGGGTGGCAGG + Intergenic
931253204 2:60551078-60551100 TTTTTTAAAGGGGTGGTGGTGGG - Intronic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
932063972 2:68533693-68533715 CATGGTACAGGGAGGGAGGTGGG - Intronic
934909155 2:98234792-98234814 CTGTGGAAAGGGAGGCTGGTTGG - Intronic
935177462 2:100662268-100662290 CCTTGGAAAGGGAGCGTGATTGG + Intergenic
935302568 2:101705776-101705798 CTTAGTAAACTGTGGGTGGTTGG + Intronic
935656784 2:105430067-105430089 TTTTGTCAAGGAAGGGAGGTGGG - Intronic
936864756 2:117064698-117064720 CTTTGTATATGGTGGGTGATGGG - Intergenic
937463709 2:122111169-122111191 CTTCGTAAAGGAAGGGTGTGGGG + Intergenic
937718599 2:125063943-125063965 GTTTGTGTGGGGAGGGTGGTTGG + Intergenic
938128211 2:128689822-128689844 CTTTGTAAATGGTGGTTGCTAGG + Intergenic
938717339 2:134032862-134032884 CTTTGAAAAGGTAGGGTTGAAGG - Intergenic
939951695 2:148483149-148483171 CTTTGTGATGGCAGGGTGGTTGG - Exonic
941791064 2:169552739-169552761 CTCAGAAAAGGGAGGTTGGTAGG + Intronic
943060387 2:183037636-183037658 CATAGGAAAGGGAGGGTGGTGGG - Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947314306 2:228838940-228838962 CTTTTCAAAGGGAAGATGGTTGG - Intergenic
947367340 2:229410161-229410183 CTTTGCAGAGAGAGGGTGTTTGG - Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948384666 2:237574108-237574130 CTCTGTAAAGGGAGGCAGGCAGG + Intergenic
948562364 2:238863126-238863148 CTTTGTAAAGATAGTGTGGCAGG + Intronic
949044322 2:241864091-241864113 GTTTGTTAAGGGGGGGTGGCAGG + Intergenic
1171158555 20:22899612-22899634 CCTTGTACAGGAAAGGTGGTAGG + Intergenic
1171333782 20:24364533-24364555 CTTTGTTGAGGGAGGGAGGGTGG + Intergenic
1174219525 20:48942391-48942413 CTTTGGAAAGCCAAGGTGGTAGG - Intronic
1178897936 21:36576069-36576091 CTTTGTTAAGAGGGGATGGTTGG - Intronic
1183112650 22:35662161-35662183 CTTTGGAAGGGAAGGGAGGTGGG + Exonic
950372218 3:12540628-12540650 CTTTGGGAAGCGAGGGTGGGAGG + Intronic
952385703 3:32840222-32840244 CTTTGGAAGGGAAGGGGGGTGGG - Intronic
952618083 3:35299889-35299911 CTCAGAAACGGGAGGGTGGTGGG - Intergenic
952833558 3:37585422-37585444 CTTGGGAGAGGGATGGTGGTTGG - Intronic
953336015 3:42094613-42094635 CTTTGGAAAGCTAAGGTGGTAGG - Intronic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
955433011 3:58870086-58870108 CCTTGTAGAGGGAGGGAGGGAGG - Intronic
956998077 3:74851067-74851089 TTCTTTAAATGGAGGGTGGTTGG - Intergenic
957586377 3:82137685-82137707 CTTTGACAATGGATGGTGGTAGG + Intergenic
957972180 3:87396641-87396663 CTCTGTAAAGAGGGAGTGGTTGG + Intergenic
959536589 3:107493255-107493277 CTTTGTCAATAGAGGGTGGTGGG + Intergenic
960397340 3:117153549-117153571 CTTTTTAAAAGGAGGTCGGTCGG - Intergenic
960535657 3:118812137-118812159 CTTTGCAAAGGGTAGGTGGATGG + Intergenic
962023028 3:131519611-131519633 CTCTGTAAAGGCAGAGTCGTAGG + Intergenic
963703323 3:148654426-148654448 CTTTGACAGGGGAGGGTGGTAGG - Intergenic
964352285 3:155815072-155815094 ATATGGAAAGGGAAGGTGGTTGG + Intergenic
964514117 3:157488806-157488828 ATTTGGAAAGGGAGGGTGAGGGG - Intronic
964752897 3:160068589-160068611 CCTTCTAAAGGGATGGTGTTAGG + Intergenic
966862920 3:184240738-184240760 CTCTGTAGAGGGTGGGTGGTGGG + Intronic
967681391 3:192368091-192368113 TTTTGGAAGGGGAGGGAGGTGGG - Intronic
969866105 4:10077984-10078006 CTTTGTGAAGGGGGGGTCGAGGG + Intronic
970428437 4:15966135-15966157 CTTTGTACAGGGAGGGTAGTGGG + Intronic
971214290 4:24649275-24649297 TATTATGAAGGGAGGGTGGTTGG - Intergenic
972742382 4:41900040-41900062 TTTTGTAAAGGGAAGTGGGTAGG - Intergenic
972985614 4:44760788-44760810 CTTTGTAAAATGAAGGTGGCAGG + Intergenic
974174682 4:58307993-58308015 CTTTGAAAAGGAAAAGTGGTGGG - Intergenic
975048521 4:69831165-69831187 CTTGGTAAAGGGGGGTTGATTGG + Intronic
976435625 4:85014479-85014501 CTTTGAAGAGAGAGGCTGGTGGG - Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
977884261 4:102238941-102238963 CTTTGAAAAGGAAAAGTGGTGGG - Intergenic
980001177 4:127489964-127489986 CTTTGTACAGGAAGGGTGTTGGG + Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
981013596 4:139951175-139951197 CTTTGTAAAGGGCCTGTGCTGGG + Intronic
984917627 4:184738079-184738101 CTTTGTTAAGGAAAAGTGGTGGG - Intergenic
987686232 5:21206654-21206676 CTTTGGACAGGCAGGCTGGTAGG - Intergenic
988490666 5:31702553-31702575 CTTTTTAAAGGCAGGGTAGGGGG - Intronic
990785268 5:59411631-59411653 CTTTATAAAGGGAGGGAATTTGG - Intronic
991384861 5:66075163-66075185 CTGTGTATATGGAGGCTGGTGGG - Exonic
993654390 5:90559153-90559175 CTTTGGAAAGGGCGGGTAGGGGG - Intronic
994163893 5:96587507-96587529 CTTTGTGATGAGAGGGTTGTTGG + Intronic
994231565 5:97314633-97314655 CTTTGAAAAGGAAAAGTGGTGGG + Intergenic
997476509 5:134145618-134145640 CCTTGGACAGGGAGTGTGGTGGG - Intronic
997706964 5:135964774-135964796 CTTTGTAAAGGGTTGTTGGCTGG + Intergenic
998090330 5:139362838-139362860 CTTTGTAAAGCAAGCATGGTCGG - Intronic
999127034 5:149253416-149253438 CTCTGTAAAGTGAGGGTGATTGG + Intronic
1000451950 5:161400430-161400452 TTTTGTAGCGGGAGGGTGGTGGG - Intronic
1001197444 5:169686277-169686299 CATTGACAAGGGAGTGTGGTCGG + Intronic
1005008462 6:21313276-21313298 CTATTTAAAATGAGGGTGGTGGG - Intergenic
1006856402 6:37136496-37136518 GTTTGGAAAGGGAGGGAGGAGGG + Intergenic
1008351206 6:50492393-50492415 CTTTGTAAAGGGACCCTGGGAGG - Intergenic
1008558832 6:52703460-52703482 ATTTGTAAAGGGAGGAGGGAAGG - Intergenic
1008680124 6:53863248-53863270 CTATGTAAAGGGAGGAGGGCAGG - Intronic
1009625016 6:66127504-66127526 CTTTGCAAGGGGTGGGAGGTGGG + Intergenic
1009673109 6:66781841-66781863 CTTTTTGAAGGGAGGAGGGTGGG + Intergenic
1011209028 6:84934770-84934792 TTTTGTAGAGGGTGAGTGGTAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013613013 6:111812625-111812647 TTTTTTTAAGGGAGGGAGGTTGG + Intronic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015612912 6:135045048-135045070 ATTTGCAAAGGGTGGGTGGGGGG + Intronic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1016068452 6:139708336-139708358 TTTTGGAATGGGATGGTGGTAGG + Intergenic
1016111162 6:140225919-140225941 ATTTGTAAAGGAAGGGGGCTGGG + Intergenic
1017152076 6:151289787-151289809 CTTTGTAAAGGGAGGGTGGTGGG + Intronic
1017313722 6:153003506-153003528 CTTTGGAAAGGGATGAGGGTTGG - Intergenic
1018174947 6:161170363-161170385 CTTGGAGAAGGGAGGGAGGTTGG - Intronic
1022205616 7:28160494-28160516 TTTTGTGAAGGGAGGCTGTTGGG + Intronic
1023243274 7:38172748-38172770 TTTTGTAAATGGAGTGAGGTAGG + Intergenic
1027427794 7:78079608-78079630 CTTTGTAAACAGTGGTTGGTTGG + Intronic
1028101258 7:86823768-86823790 TCTTTTTAAGGGAGGGTGGTGGG - Intronic
1028122841 7:87076167-87076189 CTTTTTAAGTGGAGGCTGGTGGG + Intergenic
1028455436 7:91033329-91033351 ATTTGTAAAGGAAGGGTTGAGGG - Intronic
1029364097 7:100106375-100106397 GTTTGGAAAGGGAAGGTGCTGGG - Intronic
1030314335 7:108098471-108098493 CTTTGTAAAGAGAACGTGGAAGG - Exonic
1031924717 7:127628511-127628533 TTTTTTAAAGGGAGGGGGATAGG + Intergenic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1034383193 7:150716934-150716956 CTTTGTTAAGGGAATGTGGGAGG - Intronic
1036083830 8:5590831-5590853 CTGTGTAAAGGAAGGGTTGGAGG - Intergenic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1036485816 8:9177870-9177892 TTTTGTAAAGGGAGGGTTGCAGG + Intergenic
1036976811 8:13422641-13422663 CTGGTTAAAGGGAGGGTGCTGGG + Intronic
1038755668 8:30338565-30338587 CTTTGGAAAGTCAGGGTGGGAGG + Intergenic
1041804639 8:61836745-61836767 CTCTGTCTAGGGAGGGTGGGGGG + Intergenic
1043637500 8:82404724-82404746 CTTCGTAGTGGGAGGGGGGTGGG - Intergenic
1043782053 8:84348474-84348496 CTTTGTAAAGTGATGCTGATGGG - Intronic
1044113820 8:88309421-88309443 CTATAAAGAGGGAGGGTGGTAGG + Intronic
1045035011 8:98170072-98170094 CTTTATAGAGGGAAGGAGGTCGG + Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045530886 8:102984354-102984376 CTTTGTCAAGTAAGGGTAGTAGG + Intergenic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047439419 8:124863615-124863637 CTTTGTAAATGGTGGTTGATAGG - Intergenic
1049141568 8:140959835-140959857 TGTTGGAAAAGGAGGGTGGTGGG - Intronic
1051168013 9:14286264-14286286 CTTTTGAATGGGAGGGTGCTAGG + Intronic
1053322221 9:37109255-37109277 CTTTGTATATGGAGTGAGGTAGG - Intergenic
1054840483 9:69733201-69733223 GTTTGGAAAGGGATGGTGGCAGG - Intronic
1056343186 9:85659542-85659564 CTTTTTCAAATGAGGGTGGTGGG - Intronic
1058359340 9:104124655-104124677 CTTTGTAAAAGGATAGTTGTAGG + Intronic
1058718054 9:107739792-107739814 GTTTGCAAAGGAAGGGTGGGGGG + Intergenic
1058727301 9:107816491-107816513 CTTTGGAAAAGTTGGGTGGTGGG - Intergenic
1059502944 9:114771068-114771090 GTTTGCAAAGGGAGAGTGGTGGG + Intergenic
1059701146 9:116776239-116776261 TTTTGTAAAGGAAGGGTTTTAGG + Intronic
1060347212 9:122827881-122827903 CTTTGTAAATGGAGTATGATAGG - Intronic
1060690889 9:125659004-125659026 CTTTGGAAAGGCAAGGTGGGAGG + Intronic
1060807763 9:126588262-126588284 CTCTGCACAGGGAGGCTGGTGGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1189835837 X:45021502-45021524 GATTCTAAAGGAAGGGTGGTTGG + Intronic
1189978448 X:46486098-46486120 CTTGGTGAGGGGAGGGGGGTTGG - Intronic
1190461320 X:50678867-50678889 CTTTAGAAAAGGAGGGTGGCAGG - Intronic
1192151324 X:68714510-68714532 TAGTGTAAAGGGAGGCTGGTAGG - Intronic
1195160642 X:102167446-102167468 CTTTGAAGAGGGAGGATAGTGGG - Intergenic
1198070084 X:133139587-133139609 ATTTATAAAGGGAGGGTATTTGG + Intergenic
1201874325 Y:18746122-18746144 CTTGGTAAAGGGAGGCAGATAGG - Intronic