ID: 1017156410

View in Genome Browser
Species Human (GRCh38)
Location 6:151325968-151325990
Sequence CGTTTGGTGGGGAGCCCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017156399_1017156410 28 Left 1017156399 6:151325917-151325939 CCTGGACGGCAGGCACGGGGCAC 0: 1
1: 0
2: 1
3: 21
4: 319
Right 1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 119
1017156398_1017156410 29 Left 1017156398 6:151325916-151325938 CCCTGGACGGCAGGCACGGGGCA 0: 1
1: 0
2: 1
3: 17
4: 137
Right 1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017156410 Original CRISPR CGTTTGGTGGGGAGCCCGGG AGG Intronic
900384934 1:2406180-2406202 AGTGTGGTGAGGACCCCGGGAGG + Intronic
903184612 1:21622263-21622285 CGACTGCTGGGGAGCCCGGCCGG - Intronic
903190112 1:21651704-21651726 CGCGTGGGGGGGAGCCCGTGCGG - Intronic
903233939 1:21937513-21937535 GGTTTGGCGGGGAGCCGGGCCGG - Intergenic
903333444 1:22609246-22609268 CCTTTGGTGGGGAGCAGGAGGGG + Intergenic
904111619 1:28130652-28130674 CTTTTTGTGGGGAGGCTGGGTGG - Intergenic
907140972 1:52184588-52184610 CGGGTGGTGGGGAGCGGGGGTGG + Intronic
913959198 1:143326478-143326500 CCTTTGGTGGGGAGCCGGTTGGG - Intergenic
914053515 1:144151858-144151880 CCTTTGGTGGGGAGCCGGTTGGG - Intergenic
914125682 1:144814683-144814705 CCTTTGGTGGGGAGCCGGTTGGG + Intergenic
914286076 1:146228501-146228523 CGGTTGGCGGGGAACCCCGGCGG + Intronic
914547107 1:148679254-148679276 CGGTTGGCGGGGAACCCCGGCGG + Intronic
914619400 1:149391108-149391130 CGGTTGGCGGGGAACCCCGGCGG - Intergenic
916732938 1:167582552-167582574 TGTTTGGTGGGAAGCCCTGGAGG - Intergenic
917451468 1:175151023-175151045 AGCTTGGTGGGGAGCCAGGCTGG + Intergenic
923792578 1:237124771-237124793 TTTTTGGTGGGGGGCGCGGGGGG + Intronic
1064707592 10:18089163-18089185 TGTGTGGTGGGGAGCGGGGGAGG + Intergenic
1068492649 10:57743300-57743322 GGTTTGGTGGGGAGGGCTGGTGG - Intergenic
1071568349 10:86683033-86683055 CCTTTGCTGGGGAACCCTGGGGG - Intronic
1072434700 10:95404322-95404344 TGATTGGTGGCGAGCCTGGGTGG - Intronic
1075753995 10:124796424-124796446 GGTTTGGTGGGGAGGCATGGTGG - Intergenic
1078246190 11:9574440-9574462 TGTGTGGCGGGGTGCCCGGGTGG - Exonic
1080779725 11:35419216-35419238 CGCTTGGCGGGGAGCTCCGGGGG + Exonic
1085266534 11:75240971-75240993 CGCCTGGTGGGGGGCACGGGTGG - Exonic
1088823537 11:113475478-113475500 CCTTTGGTGGGGGGCGGGGGCGG - Intronic
1089554170 11:119306157-119306179 AGTCAGGTGGGGAGCACGGGTGG + Exonic
1093336652 12:17912789-17912811 CATTTGGTGGGGAGCAGTGGAGG + Intergenic
1096489315 12:52005177-52005199 TGTTGGGTGGGGGGCCGGGGTGG - Intergenic
1097224663 12:57470435-57470457 TCTCTGGTGGGGAGCCAGGGGGG - Exonic
1100492719 12:95096914-95096936 CTTCTGGTGAGGAGCCGGGGAGG - Intronic
1105281099 13:18963035-18963057 AGTGTGGTTGGGAGGCCGGGTGG - Intergenic
1107919459 13:45189045-45189067 TGTGGGGTGGGGAGCCGGGGAGG - Intronic
1108579552 13:51817118-51817140 GGCGTGGTGGGGAGCCAGGGTGG + Intergenic
1108581029 13:51828358-51828380 CGTTTGGTGGTGTGCACGTGAGG - Intergenic
1118868028 14:69718472-69718494 GGTCTGGTGGGGAGCACGTGGGG + Intergenic
1119602007 14:75982641-75982663 CGGCTGGTCGGGAGCCGGGGAGG + Intronic
1122540535 14:102495550-102495572 GGCTGGGTGGGGAGGCCGGGCGG + Intronic
1128311544 15:66634212-66634234 AGTGTGGTTGGGAGCCAGGGGGG - Intronic
1128678064 15:69626313-69626335 GGTTGGGTGAGGAGCCCTGGAGG - Intergenic
1128782753 15:70373739-70373761 CGGTTGGTGGGGAGAGCTGGGGG + Intergenic
1132785910 16:1656902-1656924 CGGTGGGTAGGGAGCCGGGGCGG - Exonic
1136402138 16:30024796-30024818 CGGGTGATGGGGAGCCCTGGGGG + Exonic
1138472119 16:57245735-57245757 CATTTGGTCAGGAGTCCGGGAGG - Intronic
1138561299 16:57802349-57802371 CGGTGAGTGGGGGGCCCGGGCGG - Exonic
1142227563 16:88885029-88885051 CGCTTGGTGAGCAGCCCGGTGGG - Exonic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1152697665 17:81804827-81804849 CGGGTGGTGGGGCGCCGGGGGGG - Intronic
1152727926 17:81956791-81956813 CTGTGGGTGGGGAGCCCCGGGGG - Intronic
1152872982 17:82768224-82768246 TGTGTGGTGGGGATTCCGGGGGG + Intronic
1153841339 18:9010873-9010895 CATTTGGTGGGGAGGGAGGGAGG + Intergenic
1154326589 18:13395633-13395655 CGTTGGGTGGGGAGCTGGCGTGG + Intronic
1154326608 18:13395687-13395709 CGTTGGGTGGGGAGCTGGCGTGG + Intronic
1160682479 19:418121-418143 CTTTTGGTGCGGGGCCCGGGGGG - Intronic
1161072729 19:2270620-2270642 CGGTTGTGGGGGAGCCCGCGGGG + Intronic
1162030253 19:7914222-7914244 TGTTAAGTGGGGAGCCCTGGGGG + Exonic
1163156119 19:15440666-15440688 GGGGTGGTGGGGAGCCCGGCCGG + Intronic
1163294844 19:16405357-16405379 TCTGTGGTGGGGAGCCCGGTGGG + Intronic
1168290321 19:55354298-55354320 CGTTAGGGTGGGAGGCCGGGCGG - Exonic
1202692914 1_KI270712v1_random:104281-104303 CCTTTGGTGGGGAGCCGGTTGGG - Intergenic
925296313 2:2779863-2779885 CGTTGGGTGTGAAGCCTGGGAGG - Intergenic
931352048 2:61500235-61500257 CACTTTGTGGGGAGCCAGGGTGG + Intronic
933953487 2:87349686-87349708 CCTTTGGTGGGGAGCCGGTTGGG + Intergenic
934237694 2:90245934-90245956 CCTTTGGTGGGGAGCCGGTTGGG + Intergenic
934275509 2:91570797-91570819 CCTTTGGTGGGGAGCCGGTTGGG - Intergenic
937253630 2:120539928-120539950 CCTGCGGTGGGGAGCCAGGGAGG + Intergenic
944914070 2:204339619-204339641 AGTATGGTGGGGAGCGGGGGAGG + Intergenic
948434294 2:237942645-237942667 GCTTTGCTGGGGAGCCAGGGAGG + Intergenic
948594702 2:239072505-239072527 CGTGTGCTGGGGAGGCCGTGGGG - Intronic
1173728317 20:45312046-45312068 AGATAGGTGGGGAGACCGGGAGG + Intronic
1179879364 21:44287043-44287065 CTCTTGGTGGGGAGTCTGGGTGG - Exonic
1181458141 22:23070908-23070930 CGGCTGATGCGGAGCCCGGGCGG + Intronic
1181639478 22:24189160-24189182 CTGTTGGTGGTGACCCCGGGAGG - Intergenic
1182801831 22:33038118-33038140 CTTTTGGTGGGGAGCCTGGGAGG - Intronic
1182941590 22:34282239-34282261 GATTTGGTGGGGAGAGCGGGGGG - Intergenic
1183360601 22:37381239-37381261 CCTTTGGAGGGAAGCCGGGGAGG - Intronic
1184640587 22:45867992-45868014 GGAGTGGTGGGGGGCCCGGGGGG - Intergenic
957866436 3:86029919-86029941 AGTTTGGTGTGGAGCCCTTGAGG + Intronic
958736203 3:98012005-98012027 TGCTTGGTGGGGTGCCAGGGTGG + Intronic
966305562 3:178530111-178530133 TGTTTGGTGGGGAATCAGGGAGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
968697953 4:2041956-2041978 CGTCGGATGGGGAACCCGGGCGG + Intergenic
969494493 4:7518807-7518829 CGTTTGATGGGGGGCCGGGGGGG - Intronic
972740552 4:41882385-41882407 CTTTTTGTCGGAAGCCCGGGAGG + Intergenic
974657911 4:64848891-64848913 TGTGTGGTGGGGAGGCGGGGCGG + Intergenic
978162447 4:105565266-105565288 GGTTTGGAGGGGAGCCAGTGAGG - Intronic
983527454 4:168773767-168773789 AGGTGGGTGGGGAGGCCGGGTGG - Intronic
985811714 5:2094903-2094925 CGGTGGGTGGGGAGCCGGGCTGG + Intergenic
986572657 5:9181493-9181515 TGTTTGGTGGGGTGCCAGGGGGG - Intronic
989591964 5:43120924-43120946 CGTTCGGTTGGGCACCCGGGCGG - Intronic
996153093 5:120064071-120064093 CGGTAGGTGGGAAGCCTGGGCGG + Intergenic
996899951 5:128533284-128533306 CATTTGGTTTGGAACCCGGGTGG - Intronic
999105493 5:149067356-149067378 AGTTTGGTGGGCAGGCAGGGAGG + Intergenic
999231573 5:150065148-150065170 CCTTTGGTGGGGAGGATGGGAGG - Intronic
1002367409 5:178724037-178724059 CGTCAGGTGGGGAACCCTGGTGG - Intronic
1002386040 5:178868133-178868155 CGTCAGGTGGGGAACCCTGGTGG + Intronic
1003794849 6:9589672-9589694 CGTGGGGTGGGGAGGCGGGGGGG + Intergenic
1006271312 6:32969103-32969125 CCAATGGTGGGGAGTCCGGGAGG + Intronic
1006519496 6:34563120-34563142 CGGTTGGTGGGAAGTTCGGGGGG + Intergenic
1007716305 6:43858130-43858152 AGTTTTGTGGGAAGCCCAGGAGG - Intergenic
1016378657 6:143450546-143450568 CACATGGTGAGGAGCCCGGGAGG - Exonic
1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG + Intronic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1032708808 7:134444836-134444858 GGTTTGGTCGGGAGCCCCTGGGG - Intronic
1033287695 7:140056811-140056833 AGGCTGGTGGGGAGCACGGGAGG - Intronic
1033360895 7:140638506-140638528 TGTTGGGTGGGGAGGCCTGGAGG - Intronic
1038150874 8:24941881-24941903 CGGTTGGGTGGGAGCCCTGGCGG + Intergenic
1040038788 8:42896561-42896583 CGTCTAGTGGGTTGCCCGGGAGG - Exonic
1040679549 8:49792221-49792243 CATTTTGTGGGGAGCAGGGGTGG - Intergenic
1049721297 8:144116664-144116686 GGTGTGGAGGGGAGTCCGGGAGG + Exonic
1058851022 9:109012806-109012828 CGCTGGGCGGGGAGGCCGGGAGG + Intronic
1058949163 9:109887385-109887407 CGTGGGGTGGGGACCCCGGCTGG - Intronic
1060157354 9:121329007-121329029 CGTTTTGTGGTGAGCCCCTGCGG + Exonic
1060520105 9:124289512-124289534 TGTGTGTTGGGGAGCCCAGGAGG + Intronic
1061601547 9:131673691-131673713 TGTTGGGTGGGGCGGCCGGGGGG - Intronic
1062406156 9:136397620-136397642 CGTGGGGTGGGGAGCACGTGGGG + Intronic
1062406180 9:136397684-136397706 CGTGGGGTGGGGAGCACGTGGGG + Intronic
1062406186 9:136397700-136397722 CGTGGGGTGGGGAGCACGTGGGG + Intronic
1189470884 X:41313239-41313261 CAGGAGGTGGGGAGCCCGGGAGG - Intergenic
1192738911 X:73874758-73874780 TGTCTGGTGGGGAGCCATGGAGG - Intergenic
1195210957 X:102651965-102651987 CGTGTTGGGGGGCGCCCGGGAGG + Intronic
1195807042 X:108785733-108785755 CGGTTGGTGGGAAGGCAGGGTGG - Intergenic
1197952057 X:131908231-131908253 GGGTTGGGGCGGAGCCCGGGGGG + Intergenic
1199170119 X:144725842-144725864 GATTTGGTGGGTAGACCGGGAGG + Intergenic
1201759244 Y:17519230-17519252 CGTCTGCTGGGGAGCTCAGGTGG + Intergenic
1201842311 Y:18386760-18386782 CGTCTGCTGGGGAGCTCAGGTGG - Intergenic