ID: 1017158335

View in Genome Browser
Species Human (GRCh38)
Location 6:151341967-151341989
Sequence CTCGTTCTGGGTCCCGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 50}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017158329_1017158335 -2 Left 1017158329 6:151341946-151341968 CCAGCCCTAGAAAGGAAAGGCCT 0: 1
1: 0
2: 4
3: 23
4: 218
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158319_1017158335 19 Left 1017158319 6:151341925-151341947 CCCTTGATCTTGCCCCAGCCCCC 0: 1
1: 0
2: 4
3: 32
4: 358
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158321_1017158335 7 Left 1017158321 6:151341937-151341959 CCCCAGCCCCCAGCCCTAGAAAG 0: 1
1: 1
2: 9
3: 84
4: 862
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158324_1017158335 5 Left 1017158324 6:151341939-151341961 CCAGCCCCCAGCCCTAGAAAGGA 0: 1
1: 0
2: 5
3: 30
4: 354
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158320_1017158335 18 Left 1017158320 6:151341926-151341948 CCTTGATCTTGCCCCAGCCCCCA 0: 1
1: 0
2: 3
3: 55
4: 703
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158317_1017158335 26 Left 1017158317 6:151341918-151341940 CCCGCTGCCCTTGATCTTGCCCC 0: 1
1: 0
2: 2
3: 21
4: 284
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158316_1017158335 29 Left 1017158316 6:151341915-151341937 CCGCCCGCTGCCCTTGATCTTGC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158318_1017158335 25 Left 1017158318 6:151341919-151341941 CCGCTGCCCTTGATCTTGCCCCA 0: 1
1: 1
2: 2
3: 35
4: 418
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158328_1017158335 -1 Left 1017158328 6:151341945-151341967 CCCAGCCCTAGAAAGGAAAGGCC 0: 1
1: 0
2: 0
3: 24
4: 180
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158331_1017158335 -7 Left 1017158331 6:151341951-151341973 CCTAGAAAGGAAAGGCCTCGTTC 0: 1
1: 0
2: 4
3: 13
4: 193
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158325_1017158335 1 Left 1017158325 6:151341943-151341965 CCCCCAGCCCTAGAAAGGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 237
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158330_1017158335 -6 Left 1017158330 6:151341950-151341972 CCCTAGAAAGGAAAGGCCTCGTT 0: 1
1: 0
2: 0
3: 8
4: 130
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158322_1017158335 6 Left 1017158322 6:151341938-151341960 CCCAGCCCCCAGCCCTAGAAAGG 0: 1
1: 1
2: 5
3: 60
4: 507
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50
1017158327_1017158335 0 Left 1017158327 6:151341944-151341966 CCCCAGCCCTAGAAAGGAAAGGC 0: 1
1: 0
2: 2
3: 30
4: 254
Right 1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017158335 Original CRISPR CTCGTTCTGGGTCCCGTGAC AGG Intronic
901838167 1:11937478-11937500 CTCGGCCTGGGTCCCCTCACTGG + Intronic
1070161447 10:73868949-73868971 CTCGTTCTGGGCCTCGGGATTGG - Intronic
1078986669 11:16605079-16605101 CTCGGGCTGGGTCCCGGGGCGGG + Intronic
1084414505 11:69023537-69023559 CTCATTCTGGGTCCTGAAACTGG + Intergenic
1084568248 11:69943797-69943819 CTTGTTCTGGGGCCAGTGCCCGG - Intergenic
1084641009 11:70425818-70425840 CTCGTTCTTGGGCCCTTGACAGG + Intronic
1087203534 11:95370329-95370351 GTGGTTCTGGGTCCCATGAGAGG + Intergenic
1092850766 12:12624452-12624474 CCCGTTGTGAGTCCCGTGAAAGG - Intronic
1093624225 12:21327100-21327122 CTCCTTCTGGGTCCCATGGCTGG - Intronic
1098710271 12:73749361-73749383 CTGGTTCTTGGTCCTGTGATGGG - Intergenic
1099338748 12:81399431-81399453 ATCGCTCTGGGTGCAGTGACTGG - Intronic
1103984610 12:124759015-124759037 ATCGTTCAGCGTCCCCTGACAGG - Intergenic
1103999483 12:124851339-124851361 TTCTTCCTGGGTCCCGTGACAGG - Intronic
1111275356 13:85939177-85939199 CTAGTTCTGGACCCAGTGACCGG - Intergenic
1120163945 14:81174194-81174216 CTGTTTCTGGATCCAGTGACAGG + Intergenic
1135108363 16:19670706-19670728 CTCCTGCTGGGTCCCGGGAGTGG - Intronic
1137554626 16:49462845-49462867 CTCTGCCTGGGTCCCTTGACTGG - Intergenic
1145255830 17:21321864-21321886 CACGTTCTCAGTCCCGTGGCGGG + Intergenic
1149364032 17:55922762-55922784 CTCGTTCAGTGTCCTGTAACAGG + Intergenic
1151978295 17:77494723-77494745 CCCGTTCTGGGTCCCTTGGCAGG - Intronic
1158370773 18:56800938-56800960 CTGCTTCTGGGTCCTGTGAGTGG + Intronic
1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG + Exonic
1162802753 19:13120033-13120055 CTCGTTCTGGATTCCCTGGCGGG + Intronic
1165450663 19:35880228-35880250 CCCTTTCTGGGACACGTGACTGG - Intergenic
1166999789 19:46739086-46739108 CTCGTTGTGGGTGACGTGGCAGG - Intronic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
942321673 2:174741671-174741693 CACATGCTGGGTCCCCTGACTGG + Intergenic
944893825 2:204144098-204144120 CTGGTTCTGGGTCCCAGGAGGGG + Intergenic
946432147 2:219631640-219631662 CTCCATCTGGGTCCCATGACAGG - Intronic
947838296 2:233190523-233190545 GTCGTTCAGGGTCCCCTGAGTGG + Intronic
1169874525 20:10282354-10282376 CTCTTCCAGGGTCTCGTGACTGG + Intronic
1171793130 20:29546862-29546884 CTCTGCCTGGGTCCCGTGGCCGG + Intergenic
1176231843 20:64036908-64036930 CTTGTTCAGGCTCCCCTGACAGG + Intronic
1184408667 22:44314122-44314144 CTCGTCCTGGGTCGCCTGGCTGG + Intergenic
952727695 3:36605342-36605364 TTCATTCTGGGTCCCTTGGCAGG - Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
964340512 3:155704264-155704286 CTCATTCTGTTTCCCTTGACAGG - Intronic
968233811 3:197019659-197019681 CTCGTCCTGGGGCCTGTGAACGG + Intronic
969176824 4:5405188-5405210 CTCTATCTGGGTCCCGTGCTAGG - Intronic
969377459 4:6772183-6772205 CTGGTGCTGGGGCCTGTGACGGG - Intergenic
992078767 5:73215451-73215473 CTGGTTCAGTGTCCCGTGTCAGG - Intergenic
997608062 5:135191164-135191186 GCTGTTCTGGGTCCCGCGACGGG - Intronic
1003377415 6:5592816-5592838 CTCGCTCTGGGCCTCGTGGCAGG - Intronic
1011300678 6:85869515-85869537 CTTGTTCTTGGTCCTGTCACTGG + Intergenic
1016658061 6:146543708-146543730 CGGGTTCTGGGTCCTGTGACCGG + Exonic
1017158335 6:151341967-151341989 CTCGTTCTGGGTCCCGTGACAGG + Intronic
1022335399 7:29417098-29417120 CTCCTTCTGGCTCCCCTGCCAGG + Intronic
1023654314 7:42404467-42404489 CTGGTTCTGGGGCTCCTGACTGG + Intergenic
1028985211 7:97004049-97004071 CGGGTTCCGGGTCCCGGGACTGG - Intergenic
1039728899 8:40253206-40253228 CCAGTTCTGGGTCCTGTGGCCGG - Intergenic
1039848742 8:41344362-41344384 GTGGTTCTGGGTCCTGGGACTGG - Intergenic
1049441824 8:142613084-142613106 CTCGGGCTGGGTCCGGTCACTGG + Exonic
1053793151 9:41700806-41700828 CTCTGTCTGGGTCCCGTGGCCGG - Intergenic
1054181560 9:61912827-61912849 CTCTGTCTGGGTCCCGTGGCCGG - Intergenic
1054471799 9:65545162-65545184 CTCTGTCTGGGTCCCGTGGCCGG + Intergenic
1057577096 9:96251357-96251379 CAGGTTCTGGGTCCCCTGGCTGG - Intronic
1061449495 9:130660692-130660714 CTCGCTCTGGGGCCCGGGCCTGG - Intergenic
1203784677 EBV:120898-120920 CACATTCTGCGTCCCGTGAGTGG + Intergenic
1187956275 X:24522294-24522316 CTAGTTCTGGGTCTCGAGGCTGG - Intronic
1193298354 X:79858553-79858575 CCCTTTCTGCGCCCCGTGACAGG + Intergenic