ID: 1017159264 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:151350047-151350069 |
Sequence | CGATTCTCCGGACAGCCAGG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 62 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 57} |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1017159264 | Original CRISPR | CGATTCTCCGGACAGCCAGG AGG | Exonic | ||