ID: 1017159264

View in Genome Browser
Species Human (GRCh38)
Location 6:151350047-151350069
Sequence CGATTCTCCGGACAGCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017159264 Original CRISPR CGATTCTCCGGACAGCCAGG AGG Exonic
900501261 1:3005841-3005863 TGATTCTCAGGAGAGCCTGGAGG - Intergenic
900570704 1:3356912-3356934 CGAGTCTCCTGAGAGCCGGGTGG + Intronic
904701649 1:32361758-32361780 CGAGTCCCAGGACAGCCCGGAGG - Exonic
909765030 1:79345007-79345029 TGATTCTCCAGAGAGACAGGAGG - Intergenic
922212167 1:223494811-223494833 AGTTTCTCCGGGCAGCCAGAGGG + Intergenic
1062987269 10:1780325-1780347 GGAGGCTCCGAACAGCCAGGTGG + Intergenic
1062987283 10:1780382-1780404 GGAGGCTCCGAACAGCCAGGTGG + Intergenic
1075038009 10:119085462-119085484 AGCTTTTCCTGACAGCCAGGGGG + Intergenic
1077286454 11:1768089-1768111 TGACTCTCCACACAGCCAGGAGG - Intergenic
1078481176 11:11677040-11677062 AGATGCTGCAGACAGCCAGGTGG - Intergenic
1079299393 11:19264085-19264107 CGGTTCTAGGGATAGCCAGGAGG - Intergenic
1082726475 11:56743082-56743104 GGATTCTCAGGATAGCCAGGAGG + Exonic
1084426254 11:69085957-69085979 TGATTCTCCGTGCAGCCTGGGGG + Intronic
1100994524 12:100289153-100289175 CGAGGCACAGGACAGCCAGGAGG - Intronic
1120259498 14:82163758-82163780 CTCTTCTCAGCACAGCCAGGGGG - Intergenic
1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG + Intergenic
1122519528 14:102333764-102333786 GGGTTCACAGGACAGCCAGGTGG - Intronic
1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG + Intronic
1129323529 15:74787736-74787758 CCATGATCAGGACAGCCAGGGGG - Intronic
1142271214 16:89090408-89090430 CGAGTCTCCTGAAAGGCAGGAGG + Intronic
1156070043 18:33196185-33196207 CGATTATCCTGACCTCCAGGAGG + Intronic
1157216160 18:45785452-45785474 CGAGTCTCAGCACAGTCAGGAGG + Intergenic
1157434070 18:47653809-47653831 CAATTATCTGGACAGCCAAGTGG - Intergenic
1157515546 18:48308473-48308495 CGAGTCTCCTGCCAGCCTGGGGG + Intronic
1164565745 19:29324618-29324640 CCACTCTCCCCACAGCCAGGTGG + Intergenic
932000124 2:67877452-67877474 TGATTCTCCAGACAGGCAGAGGG - Intergenic
933812329 2:86040474-86040496 CGATGCTCTGGGCAGCCAGCAGG + Exonic
938406033 2:131033683-131033705 CAATTCTCCTGACAGCTTGGGGG + Intronic
941095940 2:161239176-161239198 CGATTCACCAGACAGCGAGTGGG - Intergenic
1173611618 20:44372427-44372449 GGATCCTCTGGACAGACAGGTGG - Intronic
1174141114 20:48414421-48414443 CGATGCTCTGCACAGCCTGGAGG + Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1175912728 20:62412524-62412546 CCATTCTCCAGGCAGCCAGGAGG + Intronic
1175943834 20:62549865-62549887 AGAGTCTCCGGAAACCCAGGTGG + Intergenic
1176375364 21:6084460-6084482 GGCTTCTCCAGCCAGCCAGGGGG - Intergenic
1179748110 21:43453784-43453806 GGCTTCTCCAGCCAGCCAGGGGG + Intergenic
1180046261 21:45307171-45307193 CTTGTCTCCGGGCAGCCAGGCGG + Intergenic
1180260156 21:46662972-46662994 CGACTCCCCGGCCCGCCAGGAGG - Intronic
950464321 3:13144350-13144372 TGAGTCTCCTGACAGCCACGTGG - Intergenic
956572686 3:70713856-70713878 CTATTATCAGAACAGCCAGGGGG + Intergenic
967258993 3:187623480-187623502 CGATTCTCCCCACAGCCTTGAGG + Intergenic
969626028 4:8306247-8306269 CTCTGCCCCGGACAGCCAGGAGG - Exonic
970018065 4:11534906-11534928 CGATTCTAAGGTCAGCCAGTTGG - Intergenic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
991086646 5:62653759-62653781 TGATTGACCTGACAGCCAGGAGG - Intergenic
993962459 5:94316620-94316642 TGACTCTCAGGACAGCCAGATGG - Intronic
995243976 5:109916902-109916924 TAATTCTCCTGACAGCCATGAGG + Intergenic
1007420041 6:41713720-41713742 CTATTCTCCCCAGAGCCAGGAGG + Intronic
1013273532 6:108562119-108562141 GGATTCTCCGGACAGCACCGAGG + Intronic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1017527303 6:155252829-155252851 CGAGTCTCCGAGCAGCCATGTGG - Intronic
1033613350 7:142987058-142987080 GGCTTCTCCTGACAGCCTGGAGG - Intergenic
1039832098 8:41223608-41223630 GGATTCTCCAGAGAGCCAAGAGG + Intergenic
1047906010 8:129474051-129474073 CCATCCTGCGGACAGACAGGAGG + Intergenic
1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG + Intergenic
1055319471 9:75068220-75068242 CCATTCTCCACACAGCCAGAGGG + Intronic
1057297370 9:93857094-93857116 GGATTGTCCAGACAGCCAGGAGG + Intergenic
1057685814 9:97233291-97233313 TGATGCTCAGGACAGCCAGTGGG - Intergenic
1060319683 9:122545949-122545971 CAATTCTCAGGACAGGGAGGAGG - Intergenic
1060515317 9:124262085-124262107 CCATTTCACGGACAGCCAGGGGG - Intronic
1186082233 X:5945600-5945622 GGATTCCCAGGAAAGCCAGGAGG + Intronic
1196031417 X:111097989-111098011 CAAGTCTCCGGACAGGCAGCTGG + Intronic