ID: 1017159484

View in Genome Browser
Species Human (GRCh38)
Location 6:151351449-151351471
Sequence ACTCCGGTGCAGGAGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 294}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017159477_1017159484 -2 Left 1017159477 6:151351428-151351450 CCAGACACCACAGAGGAGGCCAC 0: 1
1: 0
2: 1
3: 18
4: 231
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294
1017159470_1017159484 15 Left 1017159470 6:151351411-151351433 CCCAGTTAACCGACTCCCCAGAC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294
1017159475_1017159484 0 Left 1017159475 6:151351426-151351448 CCCCAGACACCACAGAGGAGGCC 0: 1
1: 0
2: 1
3: 34
4: 318
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294
1017159479_1017159484 -9 Left 1017159479 6:151351435-151351457 CCACAGAGGAGGCCACTCCGGTG 0: 1
1: 0
2: 3
3: 15
4: 141
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294
1017159476_1017159484 -1 Left 1017159476 6:151351427-151351449 CCCAGACACCACAGAGGAGGCCA 0: 1
1: 0
2: 2
3: 21
4: 259
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294
1017159471_1017159484 14 Left 1017159471 6:151351412-151351434 CCAGTTAACCGACTCCCCAGACA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294
1017159472_1017159484 6 Left 1017159472 6:151351420-151351442 CCGACTCCCCAGACACCACAGAG 0: 1
1: 0
2: 4
3: 23
4: 390
Right 1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017159484 Original CRISPR ACTCCGGTGCAGGAGGTGGA AGG Exonic
901382759 1:8885757-8885779 ATTCCAGTGCAGGAGGTGTGGGG - Intergenic
902299466 1:15491647-15491669 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
902602754 1:17551284-17551306 AATCTGGTGAGGGAGGTGGATGG + Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
905873635 1:41418745-41418767 ACTCCTCTGCTGGGGGTGGAGGG + Intergenic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
906857129 1:49320038-49320060 ACTCGGGAGATGGAGGTGGAAGG - Intronic
907676360 1:56521124-56521146 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
910407195 1:86900999-86901021 ACTCAGGAGCCTGAGGTGGAAGG - Intronic
911077407 1:93890983-93891005 ACTCAGGAGAATGAGGTGGAAGG - Intronic
912450253 1:109763881-109763903 GGTCCGGTGCTGGTGGTGGAAGG + Exonic
912677331 1:111695974-111695996 ACTCTGGTGCAGGATGTTGATGG + Intronic
913678282 1:121163582-121163604 ACTCAGGAGGCGGAGGTGGAAGG - Intergenic
914030121 1:143951222-143951244 ACTCAGGAGGCGGAGGTGGAAGG - Intronic
914159329 1:145116729-145116751 ACTCAGGAGGCGGAGGTGGAAGG + Intergenic
916102604 1:161406078-161406100 ACACCGGTGCAGCGGGTGGGGGG + Intergenic
917057835 1:171003631-171003653 ATTCCAGTGGAGGTGGTGGAGGG + Intronic
918548889 1:185717261-185717283 ACTCCAGTGACTGAGGTGGAAGG - Intergenic
918962834 1:191302818-191302840 ACTCTGGTGCGGGTGGTGGTAGG + Intergenic
920465589 1:206182106-206182128 ACTCAGGAGGCGGAGGTGGAAGG - Intergenic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
922674531 1:227542454-227542476 GCTCCGGCCCAGGAGGAGGAGGG - Intergenic
923247684 1:232148607-232148629 ACTCTGGTGCAGGATGTCAATGG + Intergenic
923389030 1:233495487-233495509 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
923627428 1:235625371-235625393 ACTCTGGTGCAGGATGTTCATGG - Intronic
923648276 1:235846124-235846146 TTTCTGGTGCAGGTGGTGGAGGG - Intronic
1062857052 10:784671-784693 ACCCCGGGGCGGGAGGTGGGGGG - Intergenic
1063372998 10:5533762-5533784 ACACGTGTGAAGGAGGTGGATGG + Intergenic
1066704938 10:38167031-38167053 ACTCTGGTGTAGGAGGTTGTTGG - Intergenic
1067047335 10:42991977-42991999 ACTCTGGTGCTGCAGGTGGTGGG - Intergenic
1067305310 10:45058839-45058861 ACTGCGGAGCAGGAAGTGAAGGG + Intergenic
1068283039 10:54901195-54901217 ACTCAGGAGCCTGAGGTGGAAGG + Intronic
1068890153 10:62140429-62140451 ACTCAGGAGCCTGAGGTGGAAGG - Intergenic
1070188604 10:74090907-74090929 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
1071119137 10:82257656-82257678 ACTCAGGAGCATGAGGTGGTAGG + Intronic
1072571457 10:96661496-96661518 ACTCTGGTGCTGGATGTTGATGG + Intronic
1073335934 10:102709011-102709033 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
1075061277 10:119258744-119258766 ACTCCCCTGCTGGAGGTGGGGGG - Intronic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1076598187 10:131638679-131638701 CCTCCGGAGCAGGTGGTGGCAGG + Intergenic
1077396818 11:2328213-2328235 ACTCCAGTGCAGGCCGAGGAGGG - Intergenic
1078240444 11:9526243-9526265 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
1080034834 11:27700306-27700328 CCCCCCGAGCAGGAGGTGGAGGG + Intronic
1080517179 11:33035281-33035303 ACAGAGGTGGAGGAGGTGGAAGG - Intergenic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1083701108 11:64478189-64478211 ACTCCGGAGCCTGAGGTGGGTGG - Intergenic
1085199247 11:74691814-74691836 ACTCTGATGGAGGAGGTGGCAGG + Intergenic
1085518278 11:77123773-77123795 ATTTCGGTCCCGGAGGTGGAGGG - Exonic
1086011042 11:82103786-82103808 ACTCTGGTGCAGGATGTTGGTGG + Intergenic
1086538003 11:87872392-87872414 ACCCAGGTGCAGGATGTTGATGG - Intergenic
1092192381 12:6530300-6530322 ACCCTGGTGCAGGATGTTGAAGG - Intronic
1093112656 12:15170300-15170322 ACTCTGGCACAGGAGGCGGATGG + Intronic
1093495666 12:19754033-19754055 ACTCAGGAGCCTGAGGTGGAAGG - Intergenic
1094116382 12:26919055-26919077 ACTCCGGAGGCTGAGGTGGAAGG + Intronic
1094298547 12:28935433-28935455 ACTCAGGTGGCTGAGGTGGAAGG + Intergenic
1096647325 12:53045971-53045993 ACCCTGGAGCAGAAGGTGGAGGG - Intergenic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1098895159 12:76051606-76051628 GCTCTGGTGGCGGAGGTGGAAGG - Intronic
1099125884 12:78757458-78757480 AATCTGGTGCAGGAGAAGGAAGG + Intergenic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1101496150 12:105256201-105256223 AATCCTGAGCAGGAGGTGGAAGG - Intronic
1101532875 12:105590418-105590440 CTTCCGGGGCAGGAAGTGGATGG - Intergenic
1101821335 12:108186299-108186321 ACTCTGGTGCGGGATGTTGATGG - Intronic
1102480037 12:113216588-113216610 ACTCTGGTGGGGGAGGTTGACGG + Intronic
1102496470 12:113322839-113322861 ACTCAGGAGGAGGAGGTGGGAGG + Intronic
1102896933 12:116605740-116605762 ACTCTGGGGCAGGATGTTGATGG - Intergenic
1102979869 12:117232974-117232996 ACTCAGGAGCATGAGGTGGGAGG - Intronic
1105490640 13:20884516-20884538 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
1106820528 13:33459257-33459279 ACTTGGGTGCTGGAGGTGGGAGG - Intergenic
1108499619 13:51057875-51057897 ACTCTGGTGGCTGAGGTGGAAGG + Intergenic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1110519723 13:76461233-76461255 ACTCTGGTGCAGGAGTGGAAGGG - Intergenic
1113958648 13:114113057-114113079 ACTTGGGGGCAGGAGCTGGAGGG + Intronic
1115013232 14:28576739-28576761 ACTCAGGAGCCGGAGGTGGGAGG - Intergenic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115072617 14:29343170-29343192 ACTCAGGAGTAGGAGGTGGGAGG - Intergenic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1115761214 14:36580675-36580697 ACTCTGGGGCTGGCGGTGGAGGG + Exonic
1115995246 14:39189000-39189022 ACTCCGGAGGTGGAGGTGGGAGG + Intergenic
1118050282 14:62018897-62018919 ACACCAGTGAAAGAGGTGGATGG - Intronic
1118982140 14:70725510-70725532 ACTCAGGTGCTGGTGTTGGAAGG - Intronic
1119704433 14:76775208-76775230 AGTGCCGTGGAGGAGGTGGACGG + Intronic
1121548978 14:94783794-94783816 ACTCAGGAGCCTGAGGTGGAAGG + Intergenic
1121914473 14:97824093-97824115 GAAGCGGTGCAGGAGGTGGAAGG + Intergenic
1122056288 14:99100557-99100579 ACTCAGGTACAGGTGGTGCATGG - Intergenic
1122634548 14:103123860-103123882 AGTCCTGGGCAGGATGTGGAAGG - Exonic
1122912314 14:104836852-104836874 ACGCCGGTGCAGGGGGGGGGGGG - Intergenic
1122939766 14:104976078-104976100 ACACCGGGGCAGCAGGTGCAGGG + Intronic
1125572736 15:40733424-40733446 ACTCCGGTGGCTGAGGTGGGAGG + Intergenic
1127509151 15:59623243-59623265 ACTCAGGTGGCCGAGGTGGAAGG - Intronic
1128179500 15:65589264-65589286 ACTCAGGGGGCGGAGGTGGAAGG - Intronic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1131007932 15:88993761-88993783 ACTCCGGGGGCTGAGGTGGATGG + Intergenic
1132222463 15:100115228-100115250 AGTCGGATGCAGGAGGTGGCAGG - Intronic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1132425326 15:101710970-101710992 AATTCAGGGCAGGAGGTGGACGG + Intronic
1132888813 16:2194430-2194452 ACTCTGGAGCAGGGGCTGGAGGG + Intronic
1133327261 16:4949300-4949322 ACCACGGTGGAGGAGGGGGAAGG - Intronic
1133682892 16:8137127-8137149 ACTTGAGTCCAGGAGGTGGAGGG + Intergenic
1134076959 16:11298656-11298678 ACTCAGGAGCTTGAGGTGGAAGG + Intronic
1134615443 16:15647922-15647944 ACTCCGGAGGATGAGGTGGGAGG + Intronic
1135381892 16:22002666-22002688 ACTCTGGTGGCTGAGGTGGAAGG - Intergenic
1135728454 16:24875291-24875313 ACTCAGGTGGCTGAGGTGGAAGG - Intronic
1135998183 16:27268957-27268979 ACTGAGGTGCAGGAGGCGGAGGG - Intronic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1138021443 16:53485745-53485767 ACTCCGGAGGATAAGGTGGAAGG + Intronic
1138130596 16:54476340-54476362 ACTCAGGAGAAGGAGGTAGAGGG + Intergenic
1138134760 16:54512036-54512058 ACTCGGGGGCGGGAGGAGGACGG - Intergenic
1138889539 16:61125926-61125948 ACTGTGGTGTAGGATGTGGATGG - Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141535248 16:84674701-84674723 ACTCCGGAGGCTGAGGTGGAAGG + Intergenic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141910159 16:87053277-87053299 ACACGGGAGCAGGAGGTGGCAGG + Intergenic
1142243873 16:88959604-88959626 ACCCAGGTGCAGGAGAGGGAAGG + Intronic
1143233578 17:5378770-5378792 ACTCCGATGGAAGAGCTGGAAGG - Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1144021975 17:11245699-11245721 GCTCCTGTGCAGGCAGTGGAAGG - Intronic
1144748970 17:17635080-17635102 ACTCCGGAGGCTGAGGTGGAAGG - Intergenic
1145235533 17:21205447-21205469 TCTCCGCTGCAGGAGGAGGCAGG + Intronic
1146074751 17:29717789-29717811 ACTCTGGAGGATGAGGTGGAAGG + Intronic
1146721263 17:35125328-35125350 ACTCAGGAGGTGGAGGTGGACGG + Intronic
1147180415 17:38681290-38681312 ACTCAGGTGACTGAGGTGGAAGG + Intergenic
1147776808 17:42907642-42907664 ACTGGGGTGTAGGTGGTGGAGGG + Intronic
1148426557 17:47602747-47602769 ACTCCGGAGCCTGAGGTGGGAGG - Intronic
1148911155 17:50943832-50943854 ACTCGGGAACAGTAGGTGGAAGG + Intergenic
1149354103 17:55822042-55822064 AATCAGGTGCTGGGGGTGGAGGG - Intronic
1149536281 17:57436006-57436028 ACTTCCATGCTGGAGGTGGAGGG + Intronic
1149656732 17:58313500-58313522 ACTCAGGAGCCTGAGGTGGAAGG + Intronic
1150276786 17:63903399-63903421 ACTTGGGCGCGGGAGGTGGAGGG + Intergenic
1150302676 17:64059514-64059536 GAGCCGGTGGAGGAGGTGGAAGG - Intronic
1150423182 17:65056634-65056656 CCGCCGGAGGAGGAGGTGGAGGG - Exonic
1151625436 17:75272700-75272722 GCGCCCGTGCAGGAAGTGGATGG - Intergenic
1153029270 18:698727-698749 ACTCAGGAGGCGGAGGTGGAAGG - Intronic
1154195630 18:12264343-12264365 ACTCTGGTGCTGGAGGAAGATGG + Exonic
1155675709 18:28426140-28426162 ACGCTGATGCAAGAGGTGGAGGG - Intergenic
1155995362 18:32325423-32325445 ACTCTGGTGCAGGATGTTAATGG + Intronic
1158695605 18:59700513-59700535 ACTCCTATGAAAGAGGTGGATGG - Intergenic
1158852692 18:61511253-61511275 ACTCAGGAGGATGAGGTGGAAGG + Intronic
1160503195 18:79412307-79412329 ACGTCCGTGCAGGAGGTCGAGGG + Intronic
1160881665 19:1323556-1323578 GTCTCGGTGCAGGAGGTGGAGGG + Intergenic
1160935724 19:1593607-1593629 ACTAAGGTGCAGGGGGTGGTCGG - Intergenic
1161729218 19:5948709-5948731 AATCCTGTGCAGGGGCTGGAAGG + Intronic
1161938137 19:7384798-7384820 ACTCGGGAGGAGGAGGTGGGAGG - Intronic
1162206531 19:9060252-9060274 ACTCCGGAGGCTGAGGTGGAAGG + Intergenic
1162471533 19:10874913-10874935 ACTCCGGAGGATGAGGTGGGAGG + Intronic
1163561949 19:18024508-18024530 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
1164146848 19:22517769-22517791 ACTTCAGTGCTGGAGGTGCAGGG + Intronic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165877898 19:39022553-39022575 ACTCAGGAGCATGAGGTGGGAGG - Intronic
1166164222 19:40975827-40975849 ACTCCAGTACAGAAGATGGAAGG - Intergenic
1166186611 19:41143542-41143564 ACTCCAGTACAGAAGATGGAAGG + Intergenic
1166221680 19:41369005-41369027 ACTCTGGTGGCGGAGGTGGGAGG + Intronic
1166371202 19:42302254-42302276 ACGCCGGTGCAGGACGTACAGGG - Exonic
1166845569 19:45725952-45725974 ACTTGGGCCCAGGAGGTGGAAGG - Intronic
1168435920 19:56316943-56316965 ACTCAGGTGGCGGAGGTGGGAGG - Intronic
925004789 2:433508-433530 ACTCAGGTGCAGGGGATGCAGGG - Intergenic
926065797 2:9838825-9838847 GCGCAGGTGCATGAGGTGGAAGG - Intergenic
927338511 2:21953086-21953108 ACTCCGGAGGCTGAGGTGGAAGG - Intergenic
928023895 2:27724259-27724281 GCCTGGGTGCAGGAGGTGGAGGG - Intergenic
928095140 2:28399969-28399991 ACTCTGCTCTAGGAGGTGGATGG + Intronic
931405260 2:61971015-61971037 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
932562535 2:72886207-72886229 ACTCAGGAGCCTGAGGTGGAAGG + Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
933105919 2:78325081-78325103 ACTCAGGAGGTGGAGGTGGAAGG - Intergenic
933353992 2:81192603-81192625 AATCTGGTGCTGGAGTTGGATGG + Intergenic
935754362 2:106265510-106265532 ACTCAGGAGCCTGAGGTGGAAGG + Intergenic
936114014 2:109687850-109687872 ACTCAGGAGCCTGAGGTGGAAGG - Intergenic
938595484 2:132783716-132783738 ATTACGGTGAAGGAGCTGGAGGG + Exonic
938830300 2:135043547-135043569 ACTCTGGTGCAGGCTGTTGATGG - Intronic
940289658 2:152066217-152066239 GCTCTGGAGCAGGAGGTGAAAGG - Intronic
940405852 2:153301085-153301107 ACTCAGGGGCCTGAGGTGGAAGG + Intergenic
940618637 2:156083520-156083542 GCTCCAGTGGAGGTGGTGGAGGG + Intergenic
942828824 2:180214065-180214087 ACTCCGGAGGCTGAGGTGGAAGG - Intergenic
943046614 2:182867691-182867713 ACTGCGGGGGAGGAGGTGGGGGG + Intergenic
943872852 2:193024133-193024155 ACTCTGATGCAGGATGTTGATGG - Intergenic
944299443 2:198106427-198106449 AGTCCAGTGGAGGAGGGGGATGG + Intronic
946002103 2:216491034-216491056 ACTGCAGAGCAGTAGGTGGAAGG - Intergenic
946201780 2:218074823-218074845 ACCCAGGTGCAGGAGGGAGAAGG + Intronic
947644611 2:231729289-231729311 ACTCCGATGCAGGTGGTCTATGG - Intergenic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
948666251 2:239536433-239536455 ACTCTGGTGCAGGTGTTGGGAGG + Intergenic
948765033 2:240215222-240215244 ACAGCTGTGCAGCAGGTGGAAGG + Intergenic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
1170732598 20:18987638-18987660 TCTTTGGTGGAGGAGGTGGATGG - Intergenic
1173792047 20:45834127-45834149 AGCCCGGCGCAGGAGGAGGAGGG - Intronic
1174268191 20:49347266-49347288 ACTCTGGTGCTGCAGGTGGAGGG - Intergenic
1174838252 20:53877804-53877826 ACTCCGGTGGCTGAGGTGGGAGG + Intergenic
1175136531 20:56828497-56828519 ACTCCAGTGTGGGAGGTGGGTGG + Intergenic
1175897438 20:62345513-62345535 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
1180258737 21:46651539-46651561 TCTCCAGTGCAGGCAGTGGAGGG + Intronic
1183063793 22:35350283-35350305 ACACTAGGGCAGGAGGTGGAGGG - Intergenic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1185373617 22:50471955-50471977 ACTCAGCTGCTGGAGATGGAAGG + Intronic
949710240 3:6862866-6862888 GCTCCGGTGCCGGAGGGAGACGG + Intronic
950659272 3:14456761-14456783 ACTCCCATGCAGGAGGGGCAGGG - Intronic
954240528 3:49290011-49290033 ACTCAGGTGGATGAGGTGGGAGG + Intronic
954626578 3:52025153-52025175 GCTCCGGGGCAGGAGAGGGATGG + Intergenic
955416002 3:58691564-58691586 ACTCAGGAGCCTGAGGTGGAGGG - Intergenic
955785132 3:62529607-62529629 ATTGCGGTGAAGGAGATGGATGG + Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
959506644 3:107163958-107163980 ACTCAGGTGGCTGAGGTGGAAGG + Intergenic
959619234 3:108382097-108382119 ATTCAGCTGCAGGAGGTTGAAGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
966383129 3:179363598-179363620 ACTCTGGTGGCTGAGGTGGAAGG - Intronic
966585259 3:181616630-181616652 TCTCCAGTTCAAGAGGTGGAAGG - Intergenic
966748342 3:183299288-183299310 ATTCTGGTGCAGGTGGTGCAGGG - Intronic
968446353 4:654213-654235 ACTCCAGGGCAGGAGAGGGAGGG + Intronic
968664893 4:1815615-1815637 ACTCCAGAGCAGGTGGCGGATGG + Intronic
970154806 4:13131010-13131032 ACTCCTGGGGAGGAGGTGGCGGG + Intergenic
972806267 4:42531991-42532013 ACTCGGGAGTATGAGGTGGAAGG + Intronic
973581629 4:52349638-52349660 ATTCCGGGGCAGGGGGTGGGAGG + Intergenic
975505726 4:75134572-75134594 ACTCAGGAGCCGGAGGTGGGAGG + Intergenic
975691307 4:76966753-76966775 ACTCCGGTGGCTGAGGTGGGAGG + Intronic
976209110 4:82649739-82649761 ACTCCAGTGTAAGAGGAGGAAGG - Intronic
977540600 4:98313762-98313784 ACTTCGGCCCAGGAGGTCGAGGG + Intronic
979789399 4:124759701-124759723 ACACTGGTGCAGAATGTGGATGG - Intergenic
983561888 4:169109898-169109920 ACTCCGGAGCCTGAGGTGGGAGG + Intronic
985520142 5:370409-370431 TCTCCCGTCCAGGAGTTGGATGG - Intronic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
988730880 5:33971545-33971567 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
990207959 5:53450616-53450638 ACTGCTATGCTGGAGGTGGAGGG - Intergenic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
995587395 5:113662336-113662358 ACTCGGGAGGATGAGGTGGAAGG - Intergenic
995791201 5:115889730-115889752 ACTCAGGTGTCTGAGGTGGAAGG + Intronic
996344885 5:122477515-122477537 ACTGCTGGGCAGGAGGGGGAGGG + Intergenic
996710886 5:126542554-126542576 ACTGGGGAGCATGAGGTGGAAGG + Exonic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998401235 5:141850128-141850150 ACTCAGGTGCAGGATGGGGTGGG - Intergenic
999694046 5:154172665-154172687 GCGAGGGTGCAGGAGGTGGAAGG + Intronic
999722973 5:154412510-154412532 ACTCAGGTGCAGGTGGTCCAGGG - Intronic
1001791314 5:174459865-174459887 ATCCCAGTTCAGGAGGTGGATGG - Intergenic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002639034 5:180621955-180621977 ACCCCGGGGCGGCAGGTGGATGG - Intronic
1002701677 5:181129121-181129143 ACTCAGGTGGCTGAGGTGGAAGG + Intergenic
1003021843 6:2516733-2516755 ACGCCGGGGCAGGAGGTGTATGG + Intergenic
1003504938 6:6733260-6733282 ACGCCGGTACAGGATGTTGATGG + Intergenic
1006012229 6:31052707-31052729 ACTCCGGAGGCTGAGGTGGAAGG + Intergenic
1006657530 6:35608576-35608598 ACTCCGGTGGCTGAGGTGGGAGG + Intronic
1007669147 6:43537073-43537095 ACTCGGGAGCCTGAGGTGGAAGG - Intronic
1009668169 6:66709655-66709677 ACTCCGGAGGCGGAGGTGGGAGG - Intergenic
1009923792 6:70096162-70096184 ACTCCAGCCCAGGAGGTGGAGGG - Intronic
1010420921 6:75674263-75674285 ACTCTGGGGCCTGAGGTGGAAGG - Intronic
1011314475 6:86016436-86016458 AGGCTGGTGCAGGATGTGGAAGG + Intergenic
1012558677 6:100550115-100550137 AGTTCGGTGGAGGTGGTGGAAGG + Intronic
1012922725 6:105235724-105235746 GTTCCGGTGGAGGTGGTGGAGGG - Intergenic
1016429604 6:143968864-143968886 ACTGGGGGGCAGGAGTTGGAGGG + Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1017994825 6:159522618-159522640 ACTCAGGAGCCTGAGGTGGAAGG + Intergenic
1021506896 7:21395957-21395979 ACTTGGGTGACGGAGGTGGAAGG + Intergenic
1022272307 7:28820710-28820732 ACTCAGGAGGCGGAGGTGGAAGG - Exonic
1022524519 7:31028628-31028650 ACTGAGGTGCAGGGGGTGAAGGG - Intergenic
1023141579 7:37107587-37107609 ACTCCGGTGAAGGAGATGTGAGG - Intronic
1023332287 7:39131192-39131214 ACTCTGGTTCAGGAGGGGAAGGG - Intronic
1023813616 7:43931331-43931353 ACTCAGGTGGCTGAGGTGGAAGG + Intronic
1029260672 7:99300695-99300717 ACTCAGGAGCCTGAGGTGGAAGG + Intergenic
1029302805 7:99598367-99598389 ACGACGGTGCCGCAGGTGGAGGG + Intronic
1032636618 7:133716001-133716023 ACTCTGCTGGAGAAGGTGGAAGG + Intronic
1033162361 7:139008987-139009009 ACTCCAGTGGAGGAGGTGGGAGG + Intergenic
1033579785 7:142721763-142721785 ACTCTGCTGCAGAAGGTGGTAGG + Intergenic
1033599628 7:142879571-142879593 ACTCCAGAGCTGGAGGTGGGAGG + Intronic
1034488510 7:151380935-151380957 TCACTGGTGCAGGAAGTGGATGG - Intronic
1034504116 7:151472378-151472400 ACTCTGCTGCAGCAGATGGACGG + Intronic
1034654726 7:152720378-152720400 ACTCAGGAGCCTGAGGTGGAAGG + Intergenic
1037945633 8:22987819-22987841 GATCTGGGGCAGGAGGTGGAGGG + Intronic
1039140416 8:34381126-34381148 ACTCGGGTGGATGAGGTGGGAGG + Intergenic
1040564319 8:48552453-48552475 ACTCCGGAGGCTGAGGTGGAAGG + Intergenic
1041063808 8:54061671-54061693 ACTCAGGAGGATGAGGTGGAAGG + Intronic
1041353474 8:56973952-56973974 TCTCGGGTGGAGGAGGTGGAAGG - Intronic
1042156922 8:65854151-65854173 ACTCCGGGGGAGGAGGTGGGAGG + Intergenic
1043665007 8:82799371-82799393 ACACAGGTGGAGGAGGTGAAAGG + Intergenic
1044711418 8:95062046-95062068 ACTCCGGTGCCTGAGGTGGGAGG + Intronic
1046800119 8:118417187-118417209 ACCCCGGAGGATGAGGTGGAAGG - Intronic
1047961545 8:130015555-130015577 ACCCTGCTGCAAGAGGTGGAGGG - Intronic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1049203834 8:141354278-141354300 ACACCGGTGGAGGAGGGGCAGGG + Intergenic
1049328003 8:142034086-142034108 ACCGCCCTGCAGGAGGTGGATGG - Intergenic
1049825364 8:144664231-144664253 ACTCAGGTGGCAGAGGTGGAGGG - Intergenic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1050502738 9:6315557-6315579 ATTCCGGTGGAGGTGGTGGTGGG - Intergenic
1051170018 9:14312984-14313006 ACTGCGCTGCAGGCGGTGGGCGG - Intronic
1052990553 9:34517150-34517172 ACACTGGAGCTGGAGGTGGAGGG - Intronic
1052997563 9:34559376-34559398 ACTCCAGGGCACCAGGTGGAGGG + Intronic
1056594078 9:87991070-87991092 ACTCCAGTGCAGGATATGGATGG - Intergenic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1058720971 9:107763407-107763429 ACTTGGGAGCAGGAGTTGGAGGG - Intergenic
1058958504 9:109971000-109971022 ACTCAGGTGGATGAGGTGGGAGG + Intronic
1059268614 9:113059148-113059170 ACTTTGGAGAAGGAGGTGGAAGG - Intergenic
1059269666 9:113063931-113063953 ACTTTGGAGAAGGAGGTGGAAGG - Intergenic
1059270800 9:113069379-113069401 ACTTTGGAGAAGGAGGTGGAAGG - Intergenic
1059271934 9:113074826-113074848 ACTTTGGAGAAGGAGGTGGAAGG - Intergenic
1059273068 9:113080273-113080295 ACTTTGGAGAAGGAGGTGGAAGG - Intergenic
1059274204 9:113085715-113085737 ACTTTGGAGAAGGAGGTGGAAGG - Intergenic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1190452808 X:50597945-50597967 ACTCCGGAGGCTGAGGTGGAAGG - Intronic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1193420860 X:81280422-81280444 GGTCTGGTGGAGGAGGTGGAGGG - Intronic
1196864852 X:120061537-120061559 ACTCAGGAGGATGAGGTGGAAGG + Intergenic
1196878249 X:120174795-120174817 ACTCAGGAGGATGAGGTGGAAGG - Intergenic
1197220871 X:123912524-123912546 ACTCCGGAGCCTGAGGTGGGAGG + Exonic
1197706774 X:129639858-129639880 TCTGCAGTGCTGGAGGTGGAAGG + Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic