ID: 1017161574

View in Genome Browser
Species Human (GRCh38)
Location 6:151370555-151370577
Sequence ATCAAAAATAAAACCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 691
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017161574_1017161576 21 Left 1017161574 6:151370555-151370577 CCCTCAGTGGTTTTATTTTTGAT 0: 1
1: 0
2: 2
3: 51
4: 637
Right 1017161576 6:151370599-151370621 TGTGATTTAAACATACCACTCGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017161574 Original CRISPR ATCAAAAATAAAACCACTGA GGG (reversed) Intronic
900367863 1:2318591-2318613 AAAAAAAAAAAAACCACTGCGGG - Intergenic
901120663 1:6890472-6890494 ATCAAAGACTAACCCACTGAAGG - Intronic
901308150 1:8248517-8248539 AAAAAAAAAAAAACCACTAATGG - Intergenic
901339935 1:8488225-8488247 ATAAAAAATAAAAAGTCTGATGG - Intronic
902258861 1:15208750-15208772 AGCAGAAAGGAAACCACTGAGGG + Intronic
902600434 1:17537244-17537266 AACAACAACAAAACCACTGTGGG + Intergenic
903676950 1:25070439-25070461 CTCTAGAATAAAACCACTGAGGG + Intergenic
903729384 1:25480071-25480093 ATCAAAAATAAACTCAATGCAGG + Intronic
904205885 1:28855108-28855130 ATGAAAAATGAAGCCGCTGAAGG + Intronic
907222505 1:52917230-52917252 AAAAAAAAAGAAACCACTGAAGG + Intronic
907713556 1:56906941-56906963 ATTCAAAATAAAGCCACTGCAGG - Intronic
907790034 1:57654136-57654158 ATGAAAAAGCAAATCACTGAAGG - Intronic
909152865 1:72030884-72030906 ATGGAAAAAAAAACAACTGAAGG + Intronic
909785882 1:79612564-79612586 TTCAAAAATAAAACCAAGAAAGG + Intergenic
910131928 1:83917708-83917730 ATTAAAATTACAACCACTAATGG + Intronic
910457043 1:87408907-87408929 ATTCAAAATAAAACAACTCAAGG + Intergenic
910530937 1:88234814-88234836 ATCTATAACAAAAACACTGAGGG + Intergenic
910575805 1:88762427-88762449 ATGAAAAATAAAAACAGTTAAGG - Intronic
910731112 1:90398344-90398366 ATTAAAAATGATACCACTTAGGG - Intergenic
910843181 1:91580827-91580849 TTTAAAAATACAACCACTGTAGG + Intergenic
911399316 1:97354911-97354933 ATGAAAAATAAAGAAACTGATGG - Intronic
911694447 1:100873355-100873377 AACAAAAATAAAAGCATGGATGG + Exonic
911810385 1:102269537-102269559 ATCAAAAATAAAGCAACATAAGG - Intergenic
911887453 1:103322044-103322066 ATCAAAAATAAGTTCACTGTAGG + Intergenic
912093537 1:106112517-106112539 CTCAAAAACAAAAAGACTGACGG - Intergenic
912336113 1:108864767-108864789 ATTAAAAATAATACAGCTGAGGG + Intronic
914791362 1:150880135-150880157 AACAAACAAAAAAACACTGATGG + Intergenic
915395280 1:155578808-155578830 AACAAAAAAAAAACCACACAGGG - Intergenic
916051734 1:161041273-161041295 AAAAAAAAAAAAACCACTTACGG + Intronic
916161512 1:161920592-161920614 AACAAACAAAAAACAACTGATGG - Intronic
916187955 1:162151453-162151475 AGCAAAAAGAAAACAGCTGAAGG - Intronic
916731113 1:167567599-167567621 AACAAAAAAAAAAACACTGCAGG + Intergenic
917245916 1:173000151-173000173 AGCAAAAATAATACAACTGGAGG - Intergenic
917277500 1:173346415-173346437 GTCTAAAATAAACCCACTGAAGG + Intergenic
917550303 1:176019859-176019881 CTCAAAAAAAAAATCACTAACGG + Intronic
917642800 1:176999070-176999092 ATCAAATAAAAAACTATTGAGGG + Intronic
918265423 1:182837970-182837992 ATTAAGAATAAAATCATTGAAGG - Intergenic
918294493 1:183143354-183143376 ATAATAACTAAAAGCACTGATGG - Exonic
919948047 1:202336513-202336535 ACAAAAAATAAAAACACTAAAGG + Intronic
920494902 1:206447749-206447771 CTCAAACATCAAACCACTGCAGG + Intronic
920713417 1:208316940-208316962 ATCAAAAATAAAACCAAGAATGG - Intergenic
921079671 1:211728678-211728700 ATGAAAATTAAAACCACCAAGGG - Intergenic
921535063 1:216338610-216338632 TTTAAAAGTCAAACCACTGAAGG + Intronic
922090634 1:222392050-222392072 AAAAAAAAAAAAACCTCTGAAGG + Intergenic
922115826 1:222613265-222613287 ATCAAAAATGACACTAGTGATGG - Intergenic
922147743 1:222964999-222965021 TTGAAAAAAAAAACTACTGAAGG - Intronic
922392973 1:225166206-225166228 CTCAAAAGTAAAACCATTGATGG - Intronic
923452560 1:234133123-234133145 ACCAAAAAGAAAAAAACTGAAGG - Intronic
923577297 1:235171099-235171121 ATTAAAACTAAAACCAATGCAGG - Intronic
924422313 1:243921141-243921163 ACCAAAAATAACATCTCTGAGGG - Intergenic
924478698 1:244406423-244406445 AACGAAAATGAAACCACAGATGG - Intergenic
924893483 1:248310051-248310073 AGCAAAAAGAAAAAAACTGAAGG - Intergenic
1063014550 10:2063268-2063290 ATAAAAAATAAAACAACTTTAGG + Intergenic
1063908065 10:10800738-10800760 AACAGAAAAAAAATCACTGAAGG - Intergenic
1064333029 10:14411589-14411611 ATGAAAAAAAAATCCACAGAGGG - Intronic
1064561445 10:16598556-16598578 ATCAAAAATAAAAACAGGCAGGG + Intronic
1064728363 10:18303937-18303959 ATAAAAAATAAAAACACTGGCGG - Intronic
1064915131 10:20448279-20448301 ATGAAAAATAATACCACTTTTGG + Intergenic
1065081317 10:22132622-22132644 ATCACAAATAAAAGGACTGATGG - Intergenic
1065410379 10:25420451-25420473 ATCAAAATTAAAGACACTGGGGG - Intronic
1066050450 10:31630534-31630556 ATCAAAATTAAAAACTCTTATGG - Intergenic
1066276038 10:33869744-33869766 AGAAAAAAAAAAACCACTGGGGG + Intergenic
1066332962 10:34444935-34444957 AGCAAAAACAAAACCACTGGAGG + Intronic
1066973832 10:42344987-42345009 AACAAAAAAAAAACCACTACAGG + Intergenic
1067366506 10:45635371-45635393 ATCAAAAATAAGTTCACTGTGGG - Intronic
1067731503 10:48815107-48815129 ATCCAAAAGAAAACGCCTGAAGG - Intronic
1068391236 10:56399794-56399816 ATGTAAAATAAATCCAGTGAAGG + Intergenic
1068402211 10:56543924-56543946 TAAATAAATAAAACCACTGAGGG - Intergenic
1068525553 10:58125519-58125541 AAAAAAAAAAAAAACACTGAAGG + Intergenic
1068641657 10:59414459-59414481 ATTAAAAATAGAACTACTGGTGG - Intergenic
1068802190 10:61154024-61154046 ATGAAAACTAAATCCACTGTTGG + Intergenic
1068830058 10:61483679-61483701 ATAAAAAATAAAAATACTGTTGG + Intergenic
1068916196 10:62434319-62434341 ATGAAAAACAAATCAACTGATGG + Intronic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1069403348 10:68073691-68073713 AACAGAAATAAAACCAATAATGG + Intronic
1069890821 10:71651555-71651577 AAAAAAAAAAAAACCACTGGAGG + Intronic
1069977726 10:72228349-72228371 CTCTAAAATACAGCCACTGATGG - Intronic
1070264677 10:74890773-74890795 TTTAAAAATCAAACCAATGATGG - Intronic
1071110082 10:82145542-82145564 ATCAATAAGAAAATCACTGGTGG - Intronic
1071219586 10:83448691-83448713 AACAAACAAAAAACCACTAAAGG + Intergenic
1071594229 10:86907319-86907341 ATCAAAAAGAAAACAAATGCTGG + Intronic
1072230432 10:93409747-93409769 ATCAGAAAGAAACCCAGTGAGGG + Intronic
1072395096 10:95031232-95031254 ATTAAAAAAAAAATCACTGAAGG - Intergenic
1072989454 10:100177490-100177512 AGTAAAATTAAAACCCCTGAAGG + Intronic
1073712368 10:106058180-106058202 ATCCAGAATAGAACCACTGTGGG + Intergenic
1073772949 10:106755474-106755496 AACAAATATAAATCCCCTGATGG + Intronic
1074240121 10:111630328-111630350 ATAAAACATAAAACTAGTGAAGG + Intergenic
1074839526 10:117335482-117335504 GGCAAAAATAACACCACTGATGG + Intronic
1075227598 10:120643765-120643787 CTGGAAAATAAAATCACTGAAGG + Intergenic
1075270839 10:121049068-121049090 ATAAATCTTAAAACCACTGAAGG - Intergenic
1075421831 10:122307389-122307411 ATGAAAAATTATATCACTGATGG - Intronic
1075787981 10:125062874-125062896 AATAAAAAATAAACCACTGAGGG + Intronic
1077179586 11:1206353-1206375 ATAAAAAATAAAACCCCAGAGGG + Intergenic
1078784958 11:14481205-14481227 ATCAATAACAAAACCACTAGTGG + Intronic
1079971021 11:27035329-27035351 ATCAAAAATAAAAAGCCAGAAGG + Intergenic
1080101100 11:28460539-28460561 TTCCAAAATAAAGCCACAGAAGG - Intergenic
1080469749 11:32533737-32533759 ATTAAAAACAAATCCACTCAAGG - Intergenic
1080678214 11:34447442-34447464 ATTAAAAATAAACCTACAGAGGG + Intronic
1081643718 11:44775779-44775801 ATGAAAAATAAATTCATTGATGG - Intronic
1084130924 11:67133704-67133726 CTCAAAAAAAAAACCACAGTTGG - Intronic
1085366666 11:75953613-75953635 ATTAAAAATAATCTCACTGAAGG - Intronic
1086449589 11:86902968-86902990 ATGAAAAATAACAGCACAGAGGG + Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1086800243 11:91164296-91164318 ATCCAAAAGAAAACCAGTCAAGG - Intergenic
1087054948 11:93924971-93924993 ATAAAAACAAAAACCACGGAAGG + Intergenic
1087953877 11:104259303-104259325 AACAAAAAAAAAAACAGTGATGG - Intergenic
1088173849 11:107027942-107027964 CTAAACATTAAAACCACTGAAGG + Intergenic
1088934376 11:114384235-114384257 ATCCAAAAGGAAACCATTGAAGG + Intergenic
1088962670 11:114685227-114685249 TTCTAAAAGAATACCACTGACGG + Intronic
1089089136 11:115852739-115852761 ATCAAAAATAATAAAAATGATGG - Intergenic
1089228631 11:116949495-116949517 ATAAAACAAAAAAACACTGATGG - Intronic
1089851738 11:121503164-121503186 ATCAAAATTAAAAACACGGCTGG - Intronic
1090475723 11:127018406-127018428 AAGAAAAAAAAAACCACTGCAGG - Intergenic
1093058520 12:14579012-14579034 AACAAAAACAAAAACACTGCAGG + Intergenic
1093087490 12:14882675-14882697 ACCAAAAAAAAAACCAGGGAGGG + Intronic
1093424043 12:19008155-19008177 ATGAAAAATAAAACCATAGTGGG + Intergenic
1093826279 12:23693418-23693440 ATTAAAAATAAAACCAGGGCTGG - Intronic
1094003843 12:25726297-25726319 TTTAAAAATAAAATCACAGAAGG - Intergenic
1095785479 12:46104459-46104481 ATTAAAAATAAAATCCCTGTTGG - Intergenic
1096930466 12:55202888-55202910 ATCAAAAAGAACAAAACTGAAGG + Intergenic
1097350710 12:58545678-58545700 GTCAATAATCAAACCAATGAGGG - Intronic
1097482260 12:60143455-60143477 ATAAAAATTAAAACCAATGGAGG - Intergenic
1097609225 12:61797560-61797582 AAAAAATATAAAACCACAGATGG + Intronic
1097646057 12:62235986-62236008 ATTAAAAAAAAAACAAATGAAGG + Intronic
1097884028 12:64711083-64711105 AATAAAAATAAATCCACTGGTGG + Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098399500 12:70058934-70058956 AAAAAAAAAAAAACCTCTGAGGG - Intergenic
1098601881 12:72341126-72341148 ATTAAAAAAAAAAAAACTGAAGG - Intronic
1098948513 12:76614865-76614887 ATTAAAAATAAAAGCACTGTTGG - Intergenic
1099316780 12:81093597-81093619 TTCCAAAAAAAAAACACTGAAGG - Intronic
1099556185 12:84110554-84110576 CTCAGAAATAACACCACAGATGG + Intergenic
1100585686 12:95977383-95977405 ATTAAAAAAAAAACCACTTTGGG + Intronic
1100744227 12:97627890-97627912 ATCAAAGAAAAAACCACCTAAGG + Intergenic
1100993834 12:100281011-100281033 AAAAAAAAAAAAAACACTGATGG - Intronic
1101184486 12:102260143-102260165 AACACAAATAAAACCACACATGG - Intergenic
1102151680 12:110692742-110692764 AACAAAAACAAAACAACTTAGGG + Intronic
1102702009 12:114847636-114847658 CGGAAAAATAAAACCGCTGAAGG + Intergenic
1102775145 12:115512143-115512165 ATGAAAAACAAAATCACTGAAGG - Intergenic
1103102238 12:118188142-118188164 TTCACATGTAAAACCACTGATGG + Intronic
1103169855 12:118807920-118807942 AACAAAAATAACAAAACTGAAGG - Intergenic
1103748290 12:123141203-123141225 ACAAAAAATGAAAGCACTGAGGG + Intronic
1103751759 12:123168883-123168905 CTCAAAAAAAAAAAAACTGAGGG - Intronic
1104309405 12:127640849-127640871 ATTAAAAGGAAAACCAGTGAGGG + Intergenic
1104407456 12:128530037-128530059 TCTAAAAATAAAACCACTCAGGG - Intronic
1105349883 13:19605554-19605576 ATGAAAAATAAATGCACTGAAGG + Intergenic
1105446369 13:20461048-20461070 ATAAAAAATAAAACTACAGCTGG - Intronic
1106368790 13:29111090-29111112 ATAAAAAATGGAACCACTTATGG + Intronic
1106468323 13:30032790-30032812 AGCAAAAACAAAAGCAGTGAAGG - Intergenic
1107218725 13:37954015-37954037 ATTAGAAATAAAATCACTTATGG - Intergenic
1107793823 13:44029847-44029869 ATCACAAAAGAAACCATTGAGGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109003004 13:56830822-56830844 ATAAAAAATAAAACCTCAGCTGG - Intergenic
1109117550 13:58407776-58407798 ATCAAAAAGAAAATCTCTGAAGG + Intergenic
1109993454 13:70089279-70089301 AACAAAAACAAAACAACTGACGG - Intronic
1110017281 13:70423220-70423242 CTCAAAATAAAAATCACTGAAGG - Intergenic
1110398796 13:75065563-75065585 ATTAAAAAAAAATCTACTGATGG - Intergenic
1110461456 13:75750056-75750078 ATTAAAAAAAAAACCAGTGCTGG + Intronic
1110491472 13:76113868-76113890 TGCAAACATAAAACAACTGAAGG + Intergenic
1110801502 13:79702313-79702335 GTCAAACATTAAAACACTGAAGG + Intergenic
1110920273 13:81075601-81075623 TTAAAAAATAAAACCAATGATGG + Intergenic
1111275488 13:85940023-85940045 ATTTAAAATAAATCCACTTAAGG + Intergenic
1111622152 13:90737998-90738020 ATCAAAAATAACAGAGCTGAAGG - Intergenic
1111788279 13:92818996-92819018 ATCAAAAATAAAAATACAAAAGG + Intronic
1111937340 13:94570700-94570722 ATCAAAAACAAAATCACAGCTGG + Intergenic
1112392317 13:98996809-98996831 ATAAACAATAAAACCAAGGAAGG - Intronic
1112410410 13:99158143-99158165 ATTAAAATTAAAACCACAGCAGG - Intergenic
1112422279 13:99263432-99263454 ATGAAAATTAAAACCACAGCAGG + Intronic
1112711386 13:102132820-102132842 GTCAAAAGTAAACCCACTTAAGG - Intronic
1112817462 13:103289847-103289869 ATCAAAAAGAAAACAAGTGTTGG + Intergenic
1114799590 14:25758408-25758430 ACTAAGAATAAAACCAATGAAGG - Intergenic
1114863148 14:26552748-26552770 ACCAAAAATAAAGCAAGTGATGG + Intronic
1114894840 14:26974713-26974735 AACAAAATTAAAATCACAGATGG - Intergenic
1115023569 14:28713192-28713214 AAAAAAAAAAAAACCACTAAGGG + Intergenic
1115173901 14:30540091-30540113 ATTAAAAAAAAAATCACTCAAGG - Intergenic
1115976355 14:39001331-39001353 AGAAAAAAGAAAACCAATGATGG - Intergenic
1116183555 14:41567207-41567229 ATTAAAAATGAAATGACTGATGG - Intergenic
1116368730 14:44103181-44103203 ATACAAGATAAAACCACTGGGGG + Intergenic
1117037084 14:51740894-51740916 ATCAAAAACAATATCACAGAAGG + Intergenic
1117428157 14:55622640-55622662 AGAAAAAATTAAACCACTGAAGG - Intronic
1118610956 14:67539438-67539460 CCCAACAATTAAACCACTGATGG - Intronic
1118788038 14:69063014-69063036 ATAAAAACCAAAACCACTGGGGG + Intronic
1119226941 14:72951623-72951645 AACAAAAAAAAAACATCTGAAGG + Intronic
1119399373 14:74351843-74351865 CTCAAAAAAAAAAGTACTGAGGG - Intronic
1119960140 14:78846708-78846730 AATAAAAATGAAACCACTTATGG + Intronic
1119985806 14:79136149-79136171 ATCCCATATAAAATCACTGAAGG + Intronic
1120244555 14:81991703-81991725 ATGAAAAACAAAGCCTCTGAAGG + Intergenic
1120736509 14:88058905-88058927 AGCAAAAATAACAAAACTGAAGG + Intergenic
1121195147 14:92065280-92065302 ATTAAAAAGAAACCCACTGTTGG - Intronic
1121202570 14:92131535-92131557 ATCAAAAAAAAAATCAATTATGG + Intronic
1121291717 14:92781177-92781199 ATGAAAAATAAAACCAGGTAAGG + Intergenic
1121504111 14:94463136-94463158 ATTACAAATAAAGCCACAGACGG - Exonic
1122064005 14:99159171-99159193 AAAAAAAAAAAAACCAGTGATGG - Intergenic
1122120991 14:99553349-99553371 AACAAAAAAAAAACCACACAGGG - Intronic
1122148378 14:99707746-99707768 AAAAAAAAAAAAATCACTGAAGG - Intronic
1122431306 14:101648328-101648350 ATAAAAAATAAAAAAACTAATGG + Intergenic
1202917790 14_KI270723v1_random:1032-1054 ATTAAAAAAAAAGACACTGAAGG + Intergenic
1202926835 14_KI270724v1_random:33553-33575 ATTAAAAAAAAAGACACTGATGG - Intergenic
1124390586 15:29252935-29252957 ATCAATAATTAATCCACTTACGG + Intronic
1126112197 15:45181860-45181882 ATAAAAAATAAAACCACGGCTGG + Intronic
1126247240 15:46522878-46522900 ATAAAAGATAAAACAACTAAAGG + Intergenic
1126310364 15:47309157-47309179 GTGAAAAGCAAAACCACTGATGG - Intronic
1126432724 15:48603520-48603542 ATCCAAAATAAAACCAATTTCGG - Intronic
1127017925 15:54709097-54709119 ATCAAAAAACAAACAATTGACGG - Intergenic
1127022031 15:54759052-54759074 AGCAAAAAGAAAACAACTGGAGG + Intergenic
1127239737 15:57099669-57099691 ATCAAATATAAAGTCACTAATGG - Intronic
1128426400 15:67545862-67545884 ATCAATAATAACAACACTAATGG - Intronic
1129017945 15:72485598-72485620 ATAAAAAACAAAACCATTCAGGG - Intronic
1131027962 15:89161202-89161224 AGCAAAAATAAAACTAATGAGGG - Intronic
1131877849 15:96829701-96829723 AGCAAAAATATTACCACTCAGGG - Intergenic
1134259083 16:12636391-12636413 AAAAAAAAAAAAACCACTTATGG + Intergenic
1134308499 16:13055137-13055159 ATATAAAATAATACAACTGAAGG - Intronic
1134449127 16:14353174-14353196 ATGAAAAATAAAAACCCAGAAGG - Intergenic
1135126028 16:19810038-19810060 CTCTAAAAAAAACCCACTGAAGG - Intronic
1135562938 16:23490436-23490458 ATTAAAAATAAATCCACAGCCGG + Intronic
1136506239 16:30705363-30705385 ATAAAAAATAAAAACATTGCTGG - Intronic
1136864464 16:33733860-33733882 ATTAAAAAAAAATCCACTCAGGG - Intergenic
1139970965 16:70774744-70774766 ATCAAAAAAAAAAACAAGGAAGG - Intronic
1140398456 16:74649356-74649378 TTTAAAAATAAATTCACTGATGG - Intronic
1140945083 16:79760580-79760602 ACAAAAAATAAATCAACTGAGGG + Intergenic
1143429275 17:6867867-6867889 ATGAGAAACAAAACCACTAAGGG - Intergenic
1143700660 17:8657595-8657617 AACAAAAATAAAACCATGGGGGG - Intergenic
1143998052 17:11025522-11025544 ATGAAAAATAAAACCCCTATAGG + Intergenic
1146215320 17:30974581-30974603 ACAAAAAAAAAAATCACTGAAGG - Intronic
1146246617 17:31289900-31289922 ATTAAAAAAAAAACCAACGATGG - Intronic
1147502348 17:40977436-40977458 ATAAAAAATAAAAAAAGTGATGG + Intergenic
1148230333 17:45928997-45929019 TTTAAAAATATATCCACTGATGG - Intronic
1148273430 17:46282085-46282107 AACAAAAACAAAAAAACTGAAGG - Intronic
1148964789 17:51425805-51425827 AAAAAAAAAAAATCCACTGATGG - Intergenic
1149100492 17:52900621-52900643 AAAAAAAAAAAAACAACTGAGGG - Intergenic
1150054867 17:62005307-62005329 ATTAAAAATAAAATCATAGATGG + Intronic
1150109249 17:62483824-62483846 CTCAAAAAAAAAACAACTAATGG - Intronic
1150149166 17:62794812-62794834 AACAAAAAGAAACCAACTGAAGG - Intronic
1150409628 17:64932476-64932498 AACAAAAACAAAAAAACTGAAGG + Intergenic
1150500556 17:65647066-65647088 TTCAAAAATCCAACCAGTGAAGG + Intronic
1150883453 17:69058279-69058301 CTCATTAATAAAACCATTGAAGG - Intronic
1153570331 18:6465880-6465902 AACCAAAACAAAACCACTGCTGG - Intergenic
1153720596 18:7897607-7897629 ATCAAAAATAAGATCTTTGAGGG - Intronic
1154110383 18:11563417-11563439 ATCCAACATAAAACCACTCAAGG + Intergenic
1154153633 18:11927058-11927080 AAGAAAAAAAAAACAACTGAGGG + Intergenic
1154196117 18:12268371-12268393 AAAAAAAAAAAAACCACTGGGGG - Intronic
1154253859 18:12766406-12766428 AGTAACAATAAAACCACGGATGG + Intergenic
1154946333 18:21165460-21165482 ACCAAAAATAAAATCACTGGTGG - Intergenic
1155342103 18:24823179-24823201 ATCAAAAAATAAGCCAGTGATGG - Intergenic
1155365255 18:25043113-25043135 ACCAAAAATAAATCCTCTAAAGG - Intergenic
1155610785 18:27665125-27665147 ATTAAAAATAAAACCACCTGCGG - Intergenic
1155641995 18:28029442-28029464 ATTAAAAAAAAAACCAATGATGG - Intronic
1155740873 18:29286080-29286102 ATCAAAAAAAAAATCAAGGATGG - Intergenic
1155897118 18:31343443-31343465 ATCAAAAATGGGACCACTGGTGG - Exonic
1156024456 18:32635860-32635882 AACAAACATCAAACCATTGAAGG - Intergenic
1156071908 18:33221703-33221725 ATCAAAAGCAAAGCCAGTGAAGG + Intronic
1156093807 18:33504881-33504903 ATGAAAATTAAAACCACAGTGGG - Intergenic
1156710079 18:39933004-39933026 AGCAAAAAGAAGAACACTGAAGG + Intergenic
1156794638 18:41028815-41028837 ATTAAAATTAAAAATACTGATGG + Intergenic
1157019512 18:43762654-43762676 ATCCACAAGAAAACCACTCATGG + Intergenic
1157165882 18:45358018-45358040 ATTAAAAATAAACTCTCTGAAGG + Intronic
1157422408 18:47557960-47557982 ATCTAAAAGAAAAACAGTGAGGG - Intergenic
1158560200 18:58507037-58507059 GCCTAAAATAGAACCACTGATGG + Intronic
1159434727 18:68401020-68401042 ATCAGAAATATAACAATTGAAGG + Intergenic
1160047091 18:75396627-75396649 ATAAACATTAAAACCAGTGATGG + Intergenic
1160262634 18:77309454-77309476 ATGAAAATTAAAACCACAGTGGG + Intergenic
1161187621 19:2932374-2932396 ATTAAAAAAAAAATGACTGAAGG + Intergenic
1161902162 19:7126869-7126891 AACAAAAAAAAAACCACCCAGGG - Intronic
1162410887 19:10504313-10504335 ATCAAAAATAAAGACAAGGAAGG - Intergenic
1162706452 19:12558625-12558647 AAAAAAAAAAAAACAACTGATGG + Intronic
1163096662 19:15063045-15063067 ATAAAAAAAAGAAACACTGAAGG - Intergenic
1164218993 19:23176485-23176507 ATCTAAAATAAAATTACTGGAGG + Intergenic
1164943852 19:32273499-32273521 ATTTAAAATATAAACACTGATGG - Intergenic
1165431070 19:35773474-35773496 ATAAAAAAAAAAATCACTGCAGG + Intergenic
1168330004 19:55562592-55562614 AACAAAAAAAAACCCACAGAAGG - Intergenic
1168348922 19:55664701-55664723 AACAAAAAGAAAAGCACTGGAGG - Intronic
1168524345 19:57076837-57076859 ATCATAAATCAATACACTGAGGG + Intergenic
1168693597 19:58392616-58392638 CTCAAAAAAAAAAAAACTGAAGG + Intronic
925575075 2:5351762-5351784 AAAAAAAAAAAAACCACTAAAGG + Intergenic
925792177 2:7501611-7501633 ATGAAAATTAAAACCACAGTGGG + Intergenic
925828292 2:7872237-7872259 AAAAAAAAAAAAACCACTGGAGG - Intergenic
926421709 2:12706509-12706531 ATCAAATATAAAATAAATGAAGG - Intergenic
927128485 2:20036035-20036057 AACAAAAAGAAAAACACAGAAGG + Intronic
928212371 2:29333061-29333083 ATCCAAAATAAAACAGCAGAGGG - Intronic
928897068 2:36278272-36278294 ATTAACAATTAAACCACAGATGG - Intergenic
929323705 2:40579311-40579333 ATTAAGAATAAAATAACTGAAGG - Intronic
929358421 2:41054057-41054079 GCCAAAAATGAAAGCACTGAAGG - Intergenic
929448494 2:42019716-42019738 ATCCAAGATATTACCACTGAGGG + Intergenic
929760027 2:44799039-44799061 ATCATAAATAGAACCACCCATGG + Intergenic
930159834 2:48143717-48143739 ATCAACAACAAAACCACCGGGGG + Intergenic
930688356 2:54332578-54332600 AGCACAGATAAAAACACTGATGG - Intronic
931011745 2:57924161-57924183 AGCAAAAAGAACACTACTGAAGG - Intronic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931109510 2:59095553-59095575 ATAAAAAATAAAATAACTCAAGG - Intergenic
931334830 2:61328979-61329001 AGCAGAAATAAAACCACACATGG - Intronic
931772298 2:65508375-65508397 ATCAAAATTAAGAACACTTATGG - Intergenic
931787620 2:65634495-65634517 ATCAGAAAGAAAGCCACTGTGGG - Intergenic
932219946 2:69991536-69991558 ATAACAAATAAAGCCCCTGAAGG - Intergenic
932261012 2:70327508-70327530 ATCAAAAAGAAAACAAATCACGG + Intergenic
932302816 2:70678970-70678992 GACAAAAATAGAACCACTTATGG + Intronic
932553683 2:72798850-72798872 AACAACAATAAAAACCCTGATGG + Intronic
933082401 2:78007080-78007102 ATGAAAAATAAAACCAGAGATGG - Intergenic
933456551 2:82526282-82526304 ATCAAAAACAATATCACAGAAGG + Intergenic
933696460 2:85222362-85222384 AACAAAAAAAAAAACACTAAAGG + Intronic
934962958 2:98693917-98693939 AAAAAAAATTAAAACACTGAAGG + Intronic
935158434 2:100506286-100506308 ATCACAAAGAAAACAACTAAAGG + Intergenic
935830292 2:106995112-106995134 ATAAAAAATAGAATCAGTGAAGG + Intergenic
935851943 2:107231278-107231300 TACAAAAATAATAACACTGAGGG - Intergenic
937400012 2:121574332-121574354 AAAAAAAAAAAAATCACTGATGG + Intronic
937677717 2:124609973-124609995 AGCAAAAATAAATTCACTGGAGG + Intronic
937755985 2:125539449-125539471 ACCCTCAATAAAACCACTGATGG + Intergenic
937952526 2:127399480-127399502 ATCAAACATTAAAACAATGATGG + Intergenic
939017842 2:136921947-136921969 ATTAACACTAAAAGCACTGAAGG - Intronic
939086778 2:137729142-137729164 ATGAAAAATAAAACCCCTTTGGG - Intergenic
939243004 2:139586279-139586301 AGCAGAAACAAAACCACTTAAGG + Intergenic
939301477 2:140346465-140346487 AACAACAATAAAACCACAAATGG + Intronic
939359944 2:141157847-141157869 ATCACAAATTACACCAATGAGGG - Intronic
939398040 2:141657682-141657704 ACCAAAAATAACACTACTGTTGG - Intronic
939867552 2:147490265-147490287 ATCAAATACAAAAAAACTGAAGG + Intergenic
940406254 2:153305790-153305812 ATAAAAAATAAAACCTGTCATGG - Intergenic
940565291 2:155352469-155352491 ATGGAAAGTAAAACCACAGATGG - Intergenic
940644943 2:156381388-156381410 ATAAAGTATAAAACCACTAAGGG - Intergenic
941247707 2:163121330-163121352 ATAAAAAATTAAAACCCTGAAGG - Intergenic
941374646 2:164712262-164712284 ATGGAAAATAAAAACACTCAGGG + Intronic
941548187 2:166880275-166880297 AGCAAAAATAGAACAACAGATGG + Intergenic
941873002 2:170405184-170405206 ATATAAAAGAAAACCACTGAGGG - Intronic
942424377 2:175843862-175843884 AACAAAAATAAAAGCACTGATGG - Intergenic
942443133 2:176056690-176056712 AATAAAAATAAAATCACGGATGG - Intergenic
942535149 2:176955586-176955608 AAGAAAAATAAAATCACTGAAGG + Intergenic
943244794 2:185433172-185433194 AACAAAAAAAAAACAACAGATGG - Intergenic
943250074 2:185508854-185508876 AGAAAAAATGAAACCACTCAGGG + Intergenic
943363926 2:186951447-186951469 AAAAAAAAAAAAATCACTGAAGG - Intergenic
943500045 2:188676537-188676559 ATCATAATTAAAACCACTTTAGG + Intergenic
943624534 2:190183629-190183651 ATTAAAAATAAAAACACTGGGGG + Intronic
943685840 2:190817208-190817230 ATGAAAATTAAAACCACAGTGGG + Intergenic
943842733 2:192601638-192601660 ATCAAAAACAATATCACAGAAGG - Intergenic
943866844 2:192936405-192936427 AGCAAAAACAAATCAACTGAAGG - Intergenic
944792055 2:203141209-203141231 ATCAAATTAAAAAACACTGAGGG - Intronic
945508000 2:210665296-210665318 AAGAAAAAAAAAACCACTGATGG - Intronic
945748109 2:213744074-213744096 AGCAAAAGTAAATCCTCTGAAGG - Intronic
946050220 2:216855998-216856020 ATCAAAAAAAAAAAAAATGAAGG - Intergenic
946261872 2:218499774-218499796 AACAAAAATAAAACAACCCAGGG - Intronic
947190803 2:227502619-227502641 ATCAAAAAGAAAATAAATGAGGG - Intronic
947281167 2:228456726-228456748 ATCAACAAACTAACCACTGAAGG - Intergenic
947790652 2:232866243-232866265 AGCAAAAGCAAAAACACTGAAGG - Intronic
948579632 2:238976253-238976275 ATCAAAAAAGGAAACACTGAAGG + Intergenic
949012858 2:241691449-241691471 AACAAAAACAAAAAAACTGAAGG + Intergenic
1168776872 20:455329-455351 ATTAAAAATAAAACCCCTTCTGG + Intronic
1169056023 20:2621673-2621695 ATAAAAAATAAAACCCCTAATGG + Intronic
1169689081 20:8310132-8310154 AACAAAAACAAAAGCTCTGAAGG - Intronic
1169746308 20:8946540-8946562 ATAAAAAATAAAAACACTGTCGG + Intronic
1169831316 20:9828437-9828459 TCTAAAAATAAAAACACTGACGG - Intronic
1169974512 20:11309022-11309044 ATGCAAAACAAAACCACAGAAGG + Intergenic
1170346593 20:15393680-15393702 ATCTAATAGAAAAACACTGAAGG - Intronic
1170462709 20:16593048-16593070 AACAAAAATAAAGCAAATGAGGG + Intergenic
1171086275 20:22240829-22240851 ATCAGAGAGAAAGCCACTGAGGG + Intergenic
1172067160 20:32229769-32229791 CTCAAAAAAAAAAGCATTGAAGG - Intronic
1172148445 20:32773925-32773947 AAAAAAAAAAAAACCACTGCCGG - Intronic
1172379595 20:34477232-34477254 ATTAAAAATAAAATCACGGCCGG + Intronic
1172592954 20:36130236-36130258 AACAAAAAAAAAAACACTGCTGG - Intronic
1173375131 20:42476274-42476296 AGAAAAAATAAACCCACTGGGGG + Intronic
1174090338 20:48041916-48041938 CTCAAATATTAAACCACAGATGG + Intergenic
1174351151 20:49969179-49969201 ATAGCAAATAAAACCACAGAAGG + Intergenic
1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG + Intronic
1175154304 20:56959164-56959186 ATCAAAAATGTAAGCAGTGAGGG - Intergenic
1175604514 20:60301601-60301623 ATAAAATATAAAATCACAGAAGG - Intergenic
1175668520 20:60880867-60880889 AACAAAAATATAAACACAGAAGG + Intergenic
1176970283 21:15257072-15257094 TTAAAAAAAAAGACCACTGAAGG + Intergenic
1177043698 21:16144605-16144627 ATCACAAATAAAACAACTAGAGG - Intergenic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1177413424 21:20761819-20761841 ATCTAAAATAAAAGAACTGTGGG + Intergenic
1177480290 21:21677665-21677687 ATTAAAAATAAAAGTACTTAGGG - Intergenic
1178489436 21:33039591-33039613 AGGATAAATACAACCACTGAGGG - Intergenic
1178582347 21:33847474-33847496 ATCAAGAATAAAACCTATGCTGG - Intronic
1179254446 21:39703137-39703159 ATCAAAACTCAAACCAAAGAAGG - Intergenic
1182642325 22:31778231-31778253 ATCAAAAATAAAACAAGGGCGGG + Intronic
1182751711 22:32646828-32646850 ATCCAAAACAGAACCACAGAGGG - Intronic
1183029521 22:35093094-35093116 AGCAAAAATTCAAACACTGAGGG - Intergenic
1184063484 22:42100772-42100794 CTCAAAAAAAAAAGCAATGAGGG + Intergenic
1184397564 22:44252650-44252672 ATCACAAACAAAGGCACTGAAGG + Intronic
1185113551 22:48918321-48918343 ATCAAAAATAAAAAAAATTAGGG + Intergenic
1185305232 22:50111866-50111888 ATCAAAAATAAGCAGACTGATGG - Intronic
949232658 3:1769709-1769731 ATCAAAAACAAAACATCTAATGG + Intergenic
949829029 3:8194936-8194958 AGCAAAAATAAATCATCTGAAGG - Intergenic
950736835 3:15016096-15016118 ATTAAAAATCAAATCACTGCCGG - Intronic
950946885 3:16958635-16958657 ATAAAAAATAAAGTCACTGTGGG + Intronic
951071635 3:18336002-18336024 ATAAAGAAAAAAACAACTGAGGG - Intronic
951365249 3:21773759-21773781 GTCAAAAAAAAAACAACTGCTGG + Intronic
951486481 3:23217615-23217637 ATCATTAAAAAAACCACTTAAGG - Intronic
952167127 3:30762699-30762721 ATCCAAAATAAAAAGAATGAAGG - Intronic
952530362 3:34256568-34256590 AGAATAAAGAAAACCACTGAGGG + Intergenic
953735730 3:45492684-45492706 AACAAAAATAACCCCATTGAAGG + Intronic
955071546 3:55576328-55576350 ATCCAAAATAAAAACATTAATGG + Intronic
955479910 3:59379072-59379094 ATCAAACATCAAACCAAAGATGG + Intergenic
955574759 3:60348475-60348497 AACAAAATAAAAACCACTAAAGG + Intronic
955809777 3:62775352-62775374 TTAAAAAATAAAACCACTTACGG - Intronic
956340674 3:68220513-68220535 AGAAAAAAAAAAACTACTGATGG + Intronic
956357161 3:68406579-68406601 CTCAGAAATGAAACAACTGAAGG - Intronic
956693570 3:71900002-71900024 AGTAAAAAAAAATCCACTGAAGG - Intergenic
958040908 3:88225121-88225143 ATCTAAAATATAACAACTGCTGG - Intergenic
958085634 3:88802708-88802730 AGCAAAAATAACAAAACTGAAGG - Intergenic
958086301 3:88812446-88812468 ATTACAAATAAAACCACAGCAGG + Intergenic
959060126 3:101609025-101609047 CTCAAAAAAAAAACCACAAATGG + Intergenic
959247644 3:103895239-103895261 ATGATATATAAAACCACTAATGG + Intergenic
959310689 3:104732532-104732554 ATCAAAATTAAAACAATTGATGG - Intergenic
959418684 3:106107268-106107290 ATTACATAGAAAACCACTGATGG - Intergenic
960004119 3:112764517-112764539 ATAAAAAAAAAAACCAGTGGTGG + Intronic
960629959 3:119720085-119720107 ATCAAAAAAAAAAAAACTTAGGG + Intronic
962903785 3:139783476-139783498 AACAAAAACAAAAACCCTGATGG - Intergenic
963452215 3:145496515-145496537 GCCAAAAGTAAAACCAATGATGG - Intergenic
963972798 3:151448011-151448033 ATCAAAAAATCAACCCCTGATGG + Exonic
964166103 3:153706992-153707014 AACAAAAACAAAAACACTCAGGG - Intergenic
964270791 3:154954121-154954143 AACAGAAATAAAAAGACTGAAGG + Intergenic
964580683 3:158233216-158233238 AACAAATAAAAAACCACTGGTGG - Intronic
964661946 3:159129810-159129832 ATCCAAGATAATACCACTGGGGG - Intronic
964722267 3:159779323-159779345 TTCAAAAACTAAACCACTAATGG + Intronic
965117734 3:164513958-164513980 AGCAAAAATAACAAAACTGAAGG - Intergenic
966436801 3:179894883-179894905 GTCAAAAACAAAACTTCTGAAGG + Intronic
967555983 3:190859796-190859818 ATCAACAATATAACCAGAGAAGG - Intronic
967583759 3:191188927-191188949 ATCCAAAACAACACGACTGAGGG + Intergenic
968144873 3:196289617-196289639 ATAAAAAATAAAATTACTGTTGG + Intronic
968324442 3:197800459-197800481 TTGAAAAATAAAACCACAGTGGG + Intronic
968854306 4:3107555-3107577 CTCAAAAATAACACAAATGATGG - Intronic
970012742 4:11478107-11478129 ATATAAAATAAAACAAGTGAAGG + Intergenic
970063027 4:12056799-12056821 ATTAAAAATAAAACCAAGAAGGG + Intergenic
970251211 4:14117919-14117941 CTCAAAAAGAAAATCACAGATGG - Intergenic
970314365 4:14815305-14815327 ATAAAAAATAAAAACAGGGAGGG + Intergenic
970385877 4:15555955-15555977 ATCACAACTTAAAGCACTGATGG + Intronic
970594766 4:17590121-17590143 AACAAAAATGAAACCCCTCATGG - Intronic
971117687 4:23667281-23667303 ATCAAAAGGAAAATCACTAAAGG - Intergenic
971149792 4:24020059-24020081 ATGAAAAATAAAATCTCTGCAGG + Intergenic
971734313 4:30426709-30426731 ATCAGACATAAAACCTGTGAGGG + Intergenic
971747884 4:30608188-30608210 ATCCCAATTAAAATCACTGAAGG + Intergenic
971960571 4:33481225-33481247 ATGAACAATAAAACCAATGCAGG - Intergenic
972330713 4:38062282-38062304 ATCAAAAACAAAAACACGCAGGG - Intronic
972506511 4:39724923-39724945 AACAAAAATAAGAACACTGGAGG - Intronic
972621504 4:40751487-40751509 CACAAATATAAAACCAGTGAGGG + Intronic
972910550 4:43810929-43810951 ATCCAAATTAATACCAGTGAAGG + Intergenic
973586110 4:52393124-52393146 ACCAAAAATAAAACAACCTAAGG - Intergenic
973660665 4:53103197-53103219 ATCAAAATTAACATAACTGAAGG + Intronic
973894857 4:55401814-55401836 ATTAAAAATAAAATCAATGAAGG + Intronic
974201630 4:58649368-58649390 AGCAAAAATGAAACAACAGATGG + Intergenic
974206944 4:58716867-58716889 ATCACAAATAACTTCACTGAAGG + Intergenic
974490872 4:62562957-62562979 ATTAAAAATAAAAGCATAGAAGG - Intergenic
974582267 4:63818021-63818043 ATAAAAATTAAAGCCACAGAAGG - Intergenic
975635128 4:76440766-76440788 ATCAGAAATATAAGCACTGATGG - Intronic
977107833 4:92911663-92911685 TTAAAAAAGAAAACCACAGATGG - Intronic
977253037 4:94709775-94709797 TTTAAAAAAAAAACCACTAATGG + Intergenic
977352825 4:95910096-95910118 ATTAAAAATAAAAATTCTGATGG - Intergenic
977442652 4:97088895-97088917 ATCGAATATAAAAACAATGAAGG - Intergenic
977507371 4:97919061-97919083 ATGAAAAATAAAACTACATAGGG + Intronic
978374065 4:108056912-108056934 AAAAAAAAAAAAACCACTGCAGG + Intronic
978418275 4:108502294-108502316 ATCTAAGTTAATACCACTGAGGG - Intergenic
979996574 4:127438783-127438805 AGCAAAAAGAACAACACTGATGG + Intergenic
980454288 4:133019166-133019188 ATTAGAAAAAAAACTACTGAAGG + Intergenic
980584956 4:134800248-134800270 ATAAAAAATAGAAACTCTGAGGG - Intergenic
980678030 4:136115608-136115630 ATCAAAACTACAGGCACTGATGG + Intergenic
981016680 4:139980822-139980844 AACAATAATAAAACCATTGGTGG + Intronic
981037877 4:140191127-140191149 ATCAAAGATATAACCATAGAAGG + Intergenic
981140622 4:141264396-141264418 AGCAAAAATAACAGAACTGAAGG + Intergenic
981209694 4:142088316-142088338 ATCAACATTAAAAGCAGTGATGG - Intronic
981301351 4:143189775-143189797 ATCAAAATTAAAAGCAATGGGGG - Intronic
981674312 4:147323551-147323573 ACCAGAAACAAAACAACTGAGGG + Intergenic
981813747 4:148805128-148805150 ATGAAAAATAAAACATCTGTCGG - Intergenic
983257270 4:165414099-165414121 ACCAAAAATAAAATCCATGAAGG + Intronic
983569488 4:169189598-169189620 GTTAAAAATAAAACCAGTGGTGG + Intronic
984284970 4:177717336-177717358 ATCACAGATAAAACCGCTGGAGG - Intergenic
984672721 4:182510158-182510180 AACAAAAATAATCCAACTGAAGG - Intronic
984828802 4:183952325-183952347 AACAAAAGTAAAATCAGTGATGG - Intronic
984887208 4:184460552-184460574 ATCATCCATAAAAGCACTGAAGG - Intronic
985491102 5:180188-180210 AACAAAAATAAATCCTCTGGAGG - Intronic
986847652 5:11774559-11774581 ATTAAAAAAAAAAACAATGATGG + Intronic
987107951 5:14659381-14659403 ATCAAAAATAAAACCCAGGTGGG - Intergenic
987141155 5:14947697-14947719 ATGAAAAATAAAACAACAAAAGG + Intergenic
988002153 5:25362723-25362745 ATCAAAAATAATAACTATGATGG + Intergenic
988231983 5:28491339-28491361 ATCATAAATAAATGAACTGAGGG + Intergenic
988303044 5:29458500-29458522 ATCAGAAATAAAATGACTGTTGG - Intergenic
988320640 5:29690723-29690745 AACAAAAAAAAAAACACAGAAGG - Intergenic
989625961 5:43429669-43429691 ATCTAAAAATAAAGCACTGAAGG - Intergenic
989807781 5:45632044-45632066 ATAAAAAATAAAAGCAATTAAGG - Intronic
990148001 5:52784633-52784655 AAAAAAAAAAAAACCTCTGACGG + Intergenic
990295647 5:54398918-54398940 AAAAAAAATAAAATCACTCAGGG + Intergenic
990379165 5:55205042-55205064 AGCAAAAAAAAAAACACAGATGG + Intergenic
991205902 5:64050174-64050196 ATAAAACTTAAAACCACTTATGG + Intergenic
991362392 5:65834057-65834079 AACAAAACAAAAACCACAGAAGG + Intronic
991591301 5:68254410-68254432 ATAAAAAATAAAACCCCCAAAGG + Intronic
992260798 5:74968077-74968099 AAAAAAAAAAAAAGCACTGAGGG - Intergenic
992428672 5:76685757-76685779 ATAAAAAATAAACCCACTGCTGG - Intronic
993116557 5:83726325-83726347 AAAAAAAAAAAAAACACTGAAGG - Intergenic
993136505 5:83973109-83973131 ATCAAAAATAAAATCACCCTGGG + Intronic
993219910 5:85080031-85080053 ATCAAAAATAAAAACAGAGAAGG - Intergenic
993573465 5:89571427-89571449 ATGAAACATAAATCCTCTGAGGG - Intergenic
993669874 5:90747439-90747461 ATACAAAATAAAATCATTGAAGG + Intronic
995336448 5:111005128-111005150 TTCAAAAGTAAAACCATTGGCGG + Intergenic
995697030 5:114890918-114890940 GACAAAAATAAAATCACAGATGG - Intergenic
995721580 5:115140133-115140155 ATTAAAAACAAAAGCACTGCTGG + Intronic
996428756 5:123346322-123346344 ATTACAAATAAAACCAGTGTGGG + Exonic
996469550 5:123844053-123844075 AACAAAAAGAAAACCTCTAAAGG + Intergenic
996857466 5:128025117-128025139 AAAGAAAATCAAACCACTGAGGG + Intergenic
997771688 5:136560913-136560935 ATCAAAAATGAAGAGACTGAAGG + Intergenic
998192437 5:140038299-140038321 AACAAAAATAAAACAACCGTCGG - Intronic
998474164 5:142406906-142406928 ATCAAAATTATAGCCACTGAAGG + Intergenic
998474376 5:142408261-142408283 ATCGAAATTATAGCCACTGAAGG + Intergenic
998706262 5:144765196-144765218 TTCAAAAATAAAAATTCTGATGG + Intergenic
998826843 5:146110687-146110709 AAAGAAAATAAAACTACTGAAGG + Intergenic
999942197 5:156555202-156555224 ATCAAAAATAAAAACACTTCAGG - Intronic
1000126533 5:158249995-158250017 AGTAAAAATAAAACTATTGAAGG - Intergenic
1000411620 5:160939197-160939219 ACCAAAATTTAAACCAATGATGG - Intergenic
1001155798 5:169271624-169271646 ATTAAAAAGAAAACAACTGCGGG + Intronic
1001332974 5:170775183-170775205 TTCAGAAAAATAACCACTGAAGG + Intronic
1001432260 5:171671887-171671909 TTAAAAAATCAAACCACAGAGGG + Intergenic
1002053828 5:176586949-176586971 ATGAAAAAGAAAACCCCAGAAGG + Intronic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1003742382 6:8956097-8956119 AACAAAACCAAAAACACTGATGG + Intergenic
1003780513 6:9419798-9419820 ATTAAAAAATAAACTACTGAAGG - Intergenic
1003994487 6:11525239-11525261 ATCAAAAATAAAACTTCCAAGGG + Intergenic
1004138868 6:12996337-12996359 ATCAAAAACAAAACAAAAGAAGG + Intronic
1004461169 6:15837763-15837785 ACCAAAAATAAAACCTCAAATGG + Intergenic
1004788696 6:18998992-18999014 CTCTAACATAAAACCACTCAGGG - Intergenic
1005142275 6:22646467-22646489 ATCTGAAATAAAAATACTGAGGG - Intergenic
1005394818 6:25370416-25370438 CTCAAAAATAAACACAGTGATGG - Intronic
1005473082 6:26181410-26181432 ATGAAAAAAAAAACCTCTGATGG - Intergenic
1006556869 6:34874536-34874558 AACAAACACAAAACCACAGAAGG + Exonic
1006573393 6:35024388-35024410 ATGAAAGAGAAAACCACAGAAGG + Intronic
1007083649 6:39127335-39127357 ATTAAAAAAAAAACAACTGATGG + Intergenic
1008479473 6:51970152-51970174 ATGAAAATTAAAACCACAGTGGG - Intronic
1009595804 6:65734386-65734408 ATCAAAATTAACAACACTGGAGG - Intergenic
1009670555 6:66743438-66743460 ATCAAAATGAAAATTACTGATGG + Intergenic
1009688444 6:66993504-66993526 AACAAAAGCAAAAACACTGAGGG - Intergenic
1009696242 6:67107563-67107585 ATCAAAAATAACAAAACTGGAGG + Intergenic
1009898625 6:69783870-69783892 ATTAAAAATAAAAAGTCTGAAGG + Intronic
1010577686 6:77552829-77552851 ATAAAACATAAAAACACTTAGGG + Intergenic
1011094772 6:83648629-83648651 ACTAAAATTAAAACTACTGATGG - Intronic
1011808740 6:91104343-91104365 AACAAAAATGAAATTACTGAAGG - Intergenic
1011927357 6:92663215-92663237 ATGAAAAATTAAACAAGTGAAGG + Intergenic
1012205199 6:96452698-96452720 ATAAGAAAAAAAAACACTGAGGG + Intergenic
1012539931 6:100351005-100351027 TTCAAAAATAAAACACTTGAAGG + Intergenic
1012656263 6:101825391-101825413 GTCAAATATAAAACTATTGATGG + Intronic
1012695965 6:102384124-102384146 TTCAAAAGTAAAACAACAGAAGG + Intergenic
1013916313 6:115341700-115341722 ATCAAAATTAAAAACAAAGAGGG + Intergenic
1014098479 6:117483867-117483889 ATCAAAACTAAAACCAATGCCGG + Intronic
1014101109 6:117512888-117512910 ATCAGAAATAATACTACTAAGGG + Intronic
1014288125 6:119526559-119526581 ATTAAAATTAAAGCAACTGATGG + Intergenic
1014686814 6:124512020-124512042 TTCAAGAATAAAATCAGTGAGGG - Intronic
1015020900 6:128473354-128473376 GTCAAAATTAATATCACTGAGGG - Intronic
1015181163 6:130364626-130364648 GGTAAAAATAAAACCACAGATGG + Intronic
1015783216 6:136893182-136893204 AAGAAAAAAAAAGCCACTGAAGG - Intronic
1016192104 6:141282100-141282122 AAGAAAAATAAAACCATGGATGG + Intergenic
1016211265 6:141537368-141537390 AGCAAAAATAAACCCAAAGAAGG - Intergenic
1016434775 6:144024704-144024726 CTCAAAAATAAAAACAATAATGG + Intronic
1016707590 6:147129787-147129809 ATGAAAAAAAAAAACAGTGAGGG + Intergenic
1016722397 6:147316691-147316713 ATCAAGACTAAAAACACTGATGG - Intronic
1016760770 6:147734166-147734188 ATAAAAACTAAAACCACTTAAGG - Intronic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017504377 6:155054187-155054209 AACAAAACAAAAACCACTGTTGG + Intronic
1018279658 6:162172085-162172107 ATAAAAAAGAAAACCACCTAAGG + Intronic
1018507427 6:164486388-164486410 AGCAAAAATAACAAAACTGAAGG - Intergenic
1018931737 6:168244358-168244380 ATGAAAAAGAAAACCTCCGATGG - Intergenic
1019007454 6:168812108-168812130 ATGGAAAATAAAACCACTTTTGG + Intergenic
1019157549 6:170049434-170049456 AAGAAACACAAAACCACTGAGGG - Intergenic
1019338768 7:497984-498006 ACAAAAAAAAAAACCACTTAAGG + Intronic
1019377845 7:704988-705010 ATGTAAAATAAAACCACTTTAGG + Intronic
1020337612 7:7074226-7074248 ATTACAAATATAACCACAGAGGG - Intergenic
1020553619 7:9640641-9640663 AAGAAATATAAAACCACCGATGG - Intergenic
1020839799 7:13201845-13201867 ATCAGAAAAAAAAAAACTGATGG + Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021537224 7:21719496-21719518 ATCAAAACAAAAAAGACTGAAGG - Intronic
1022066674 7:26865315-26865337 ATCAAAAATAAAATTGCTGGTGG + Intronic
1022150514 7:27599187-27599209 ATCCAAAATAACAACTCTGACGG - Intronic
1022789403 7:33672049-33672071 AGCCAAAATAAAAACAGTGAGGG - Intergenic
1023027891 7:36067653-36067675 ATCAAAAAAAAAAAAAATGAAGG - Intergenic
1023241131 7:38148619-38148641 AACAAAAACAAAAACCCTGAAGG + Intergenic
1023898973 7:44460087-44460109 AACATAAAGAAAATCACTGAAGG + Intronic
1024162053 7:46686863-46686885 ATTAAAAATAGAACTACTGCAGG + Intronic
1024621935 7:51167630-51167652 AGCAAAAATAACAAAACTGAAGG + Intronic
1027300780 7:76831881-76831903 ACCAAAAATAAAAGAACAGAGGG + Intergenic
1027431955 7:78123751-78123773 ATCTATAATAAAACCTCGGAAGG + Intronic
1027849329 7:83429605-83429627 TTCAAAAACAAAAGCACTGCAGG - Intronic
1028123942 7:87089735-87089757 CTGAAAAATAAAAACACTGCAGG - Intergenic
1028273626 7:88823835-88823857 GTAAAAAAGAAAAGCACTGATGG + Intronic
1028874104 7:95801248-95801270 ATAAACAATAAAAACATTGAGGG - Intronic
1029010561 7:97257546-97257568 ATCAAAAATAAAAGCTGTGAGGG + Intergenic
1030599760 7:111580419-111580441 ATTCAAAATAAAACCACACATGG + Intergenic
1030780920 7:113598773-113598795 ATCTAAAAGAAAACCACAAAAGG + Intergenic
1030850511 7:114479169-114479191 AACAAAAACAAAACCACTACTGG - Intronic
1030880885 7:114877650-114877672 GTCAAAAATAAATTCACTGTAGG + Intergenic
1031058465 7:117021150-117021172 ATCAAAATTGAAGCCACTGTGGG - Intronic
1031352829 7:120756401-120756423 ATCAGGAAAAAAACCATTGAAGG + Intergenic
1031667358 7:124501042-124501064 ATCTAAAATTAAACTAATGAAGG + Intergenic
1031674063 7:124587674-124587696 AAAAAAAAAAAAACCACTAATGG + Intergenic
1031825998 7:126566517-126566539 ATCAAAAAAACAACCAATGTTGG + Intronic
1031955923 7:127942238-127942260 GTCAAAAATAAGACCCTTGAAGG - Intronic
1031988774 7:128181770-128181792 AACAAAGAGAAAACCCCTGAGGG + Intergenic
1032038266 7:128536342-128536364 CTCAAAAAAAAAAACACTAATGG - Intergenic
1032244577 7:130198630-130198652 AACAAAAATGAAACCATTTAAGG + Intronic
1032788323 7:135219639-135219661 AACAAAAACAAAACAACAGAAGG - Intergenic
1032951009 7:136912673-136912695 ATCAAAAATAATAGCACTTTAGG - Intronic
1033674714 7:143528946-143528968 AGCAAAAATAAAAACACCAAAGG - Intergenic
1033686022 7:143642294-143642316 ACCAAGAACAAAACCAATGAGGG + Intronic
1033689720 7:143725021-143725043 ACCAAGAACAAAACCAATGAGGG - Exonic
1033697122 7:143800493-143800515 AGCAAAAATAAAAACACCAAAGG + Intergenic
1033698591 7:143815327-143815349 ACCAAGAACAAAACCAATGAGGG - Intergenic
1033786807 7:144741592-144741614 GTTAAAAATATAACAACTGAAGG - Intronic
1035057360 7:156044513-156044535 AAAAAAAAAAAAAACACTGAAGG + Intergenic
1035951456 8:4026488-4026510 ATTAAGAAGAAAACCACTGGAGG + Intronic
1036082209 8:5569023-5569045 ATCAAAAATAAAAACAATAAAGG + Intergenic
1036531393 8:9591588-9591610 AATAAAAATAAAACCAAAGATGG - Intronic
1036821087 8:11940681-11940703 ATAAAAAATAAAAAAAGTGATGG + Intergenic
1037720704 8:21441494-21441516 CTCAAAGATAAAACCATTTAAGG - Intergenic
1037728258 8:21501927-21501949 ATCAAAAGTTAAAGCCCTGAAGG - Intergenic
1038563491 8:28600345-28600367 AACAAAAACAAAAACAATGATGG + Intergenic
1039019513 8:33189550-33189572 AGCAAAAAGAACAACACTGAAGG + Intergenic
1039286412 8:36046058-36046080 ATGCAAAAAAAAGCCACTGAGGG + Intergenic
1040360752 8:46662041-46662063 ATCAAAACTACAACCACAGCTGG - Intergenic
1041046406 8:53890983-53891005 AACAAACTTAAAACCTCTGAAGG - Intronic
1041566020 8:59280096-59280118 CTCAAAAAAAAAACCACGTATGG - Intergenic
1041932474 8:63302062-63302084 ATCAACTAAAAAGCCACTGAGGG - Intergenic
1042054585 8:64750496-64750518 ATGAAAAATAAACCAACAGATGG - Intronic
1042126866 8:65546809-65546831 ATATAAAATAAAGACACTGAGGG - Intergenic
1042561893 8:70078252-70078274 AACAAAAACAAAACCACCCATGG - Intergenic
1042626356 8:70762136-70762158 ATCAAAAATAACAAAGCTGAAGG - Intronic
1042774206 8:72411629-72411651 ATCATTAATAATACCACTGCTGG + Intergenic
1042948192 8:74175643-74175665 ATCAGAAATAAATCATCTGAAGG + Intergenic
1043205997 8:77441183-77441205 ATTAAAAATGAAACCATTGTAGG - Intergenic
1044495391 8:92872592-92872614 AAGAAAAAAAAAATCACTGAAGG + Intergenic
1044519803 8:93186328-93186350 ATCAAAAATAAAATTAGTCAGGG + Intergenic
1044977398 8:97678248-97678270 AACTAAACAAAAACCACTGATGG + Intronic
1045127629 8:99110384-99110406 AATAAAAATAAAACAATTGATGG - Intronic
1045521671 8:102908477-102908499 ATTAAAAATAGAACCACCGTAGG + Intronic
1045524723 8:102931928-102931950 ACAAAAAACAAAACCACTGAGGG - Intronic
1045981272 8:108191079-108191101 ATCAAAGAGCAAACCACTTATGG + Intergenic
1046018545 8:108635593-108635615 ATTAAAAATAAACCCAGTGTTGG - Intronic
1046038848 8:108877900-108877922 ATCATAAAGAAAAACATTGATGG - Intergenic
1046077373 8:109329389-109329411 ATCATAAAGAAAACCACAGCTGG + Intronic
1046493256 8:114981272-114981294 ATCAAAAACAAAAACTCTCATGG - Intergenic
1046558166 8:115802622-115802644 ATCCTAAATAAAACAAGTGATGG - Intronic
1046653606 8:116869078-116869100 ATCAAAAACACAACCCATGAAGG + Intronic
1047059118 8:121203240-121203262 ATCAAAAAGAAAAAAAATGATGG + Intergenic
1047596062 8:126378957-126378979 ATAAAAAATAAAAAAATTGAAGG + Intergenic
1047963123 8:130025265-130025287 GGCAAAAAGAAAACCACTTATGG - Intergenic
1048157829 8:131977744-131977766 ATTAAAAATACAACCACACAAGG - Intronic
1048249151 8:132844747-132844769 ATATAAAAGAAAACCACTTAAGG - Intronic
1048416610 8:134234057-134234079 ATCAGAAAAAAAACAACTAATGG + Intergenic
1050035579 9:1432530-1432552 AAAAGAAATAAAACCATTGAAGG - Intergenic
1050459458 9:5864974-5864996 ATGGAAAAAAAAATCACTGAAGG + Intergenic
1050945728 9:11514742-11514764 AACAAACCTAAAATCACTGAAGG - Intergenic
1052220224 9:26012688-26012710 AGCAAAAATAAAATCAGTTAGGG - Intergenic
1052254274 9:26435696-26435718 TTTAAAAATAAAACCATTAATGG + Intergenic
1052491811 9:29179060-29179082 GGCAAAAATTAAACCACTTAGGG + Intergenic
1052539222 9:29786446-29786468 AGCAAAAATAAAAAAACTGGAGG + Intergenic
1053737717 9:41112049-41112071 ATCAAAAACAATATCACAGACGG - Intergenic
1054690631 9:68319270-68319292 ATCAAAAACAATATCACAGACGG + Intergenic
1055216309 9:73867154-73867176 ATCAAAAATATCTCCAATGATGG - Intergenic
1056700637 9:88903490-88903512 ATATAAAATAAAACTACAGAAGG - Intergenic
1057565368 9:96161849-96161871 ATCACAAAAAGAACCATTGAAGG - Intergenic
1058521595 9:105818294-105818316 ATCAAAAACAATATCACAGAAGG - Intergenic
1058737380 9:107906286-107906308 ATCAAAAATGCAAGCAGTGAAGG - Intergenic
1059077058 9:111204663-111204685 AGCAAAAAGAACAACACTGAAGG + Intergenic
1059310294 9:113384165-113384187 ATTAAAAATAAAACTAGTGAAGG - Intergenic
1060790061 9:126480000-126480022 AGAAAAAATATGACCACTGAAGG + Intronic
1060935356 9:127511506-127511528 TTAAAAAAAAAAACCACTGGGGG + Intronic
1061344640 9:130013133-130013155 ATAAAAAATAGAACAATTGAAGG - Intronic
1061476141 9:130867928-130867950 AAAAAAAAAAAAACCACTGGAGG - Intronic
1062108558 9:134769081-134769103 ATCAAAACCAAAACCACAGCAGG - Intronic
1062286680 9:135776231-135776253 AACAAAAAAGAACCCACTGAGGG - Intronic
1062672469 9:137719638-137719660 ATCAAAGACATCACCACTGAAGG - Intronic
1186307713 X:8281959-8281981 ATGAATCACAAAACCACTGAGGG - Intergenic
1186387713 X:9126882-9126904 AGCAAACATAAACCCAGTGAAGG + Intronic
1186861842 X:13680448-13680470 ACCAAAAATAAAACCCCTGCTGG - Intronic
1186881586 X:13872063-13872085 ATCAGAAATAAAACTTCTCAGGG - Intronic
1187381891 X:18809707-18809729 AAAAAAAAAAAATCCACTGAAGG + Intronic
1187479673 X:19643727-19643749 TTCAAAAATTAAACAGCTGATGG - Intronic
1187580970 X:20606953-20606975 AGCAAAACTAAAACCAGAGAAGG - Intergenic
1187846916 X:23549110-23549132 AGCAAAAACAAAACCACAAAGGG - Intergenic
1188750128 X:33894643-33894665 ATCAGAAATAATGCCATTGAAGG + Intergenic
1189698571 X:43692617-43692639 AAAAAAAAAAAAACCACGGAAGG + Intronic
1189835535 X:45017506-45017528 ATAAGAAATAAAAACACTGGGGG - Intronic
1191059006 X:56274941-56274963 AGCAAAAATAATAAAACTGAAGG - Intronic
1191632059 X:63332014-63332036 AAAAAAAAAAAAACAACTGAAGG + Intergenic
1192490569 X:71573057-71573079 ATGAAACAGAAAACCACTCAAGG - Intronic
1192963815 X:76156535-76156557 ATCAAATATGAATCCAGTGAGGG + Intergenic
1193238650 X:79139886-79139908 AATAAAAATAAAACCACTCCTGG + Intergenic
1193874950 X:86850874-86850896 AGCAAAAAGAACACAACTGAAGG - Intergenic
1194111991 X:89845584-89845606 AACAAAAAAAAAAGCACTGAAGG + Intergenic
1194611028 X:96045315-96045337 CTCAAAAATAAATCCATTCATGG - Intergenic
1195027808 X:100895624-100895646 ATCAACAACAAAAACAATGATGG + Intergenic
1195402469 X:104475964-104475986 CTCAAAATTAAAACCAGAGAAGG + Intergenic
1196353220 X:114757624-114757646 ATAAAAACTAAAATCTCTGAAGG + Intronic
1196716301 X:118814340-118814362 ATTAAAAAGAGAACCACAGAGGG - Intergenic
1197068311 X:122261684-122261706 AACAAAAATAAGATCACTGTAGG + Intergenic
1197226098 X:123958057-123958079 ATGAAAAATGAAATAACTGATGG - Intergenic
1197333660 X:125184868-125184890 ATAAAAATTAAAACCAATGAGGG + Intergenic
1197544662 X:127810321-127810343 AACAAAAAGAAAACATCTGAAGG + Intergenic
1197916900 X:131545155-131545177 AGCAAAAATAATACCTCTAATGG - Intergenic
1199180238 X:144845931-144845953 TTCAAAAACAAAACCAGTGGTGG - Intergenic
1199460616 X:148080468-148080490 ACAAAAAAAAAAACCACTAATGG + Intergenic
1201558364 Y:15288684-15288706 ATAAAATATAAAACCAAGGAAGG + Intergenic