ID: 1017162059

View in Genome Browser
Species Human (GRCh38)
Location 6:151374354-151374376
Sequence CCTTCTAGCCAAAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017162049_1017162059 29 Left 1017162049 6:151374302-151374324 CCTTGTGGAGGGAGGAAACCGGT 0: 1
1: 0
2: 0
3: 13
4: 207
Right 1017162059 6:151374354-151374376 CCTTCTAGCCAAAAGGTGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 117
1017162050_1017162059 11 Left 1017162050 6:151374320-151374342 CCGGTCTTGAGAAGTATAAGTAA 0: 1
1: 0
2: 0
3: 13
4: 244
Right 1017162059 6:151374354-151374376 CCTTCTAGCCAAAAGGTGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017162059 Original CRISPR CCTTCTAGCCAAAAGGTGGG AGG Intronic
901062846 1:6481070-6481092 TCATCTAGCTAAAAGGTGGCTGG - Intronic
901081645 1:6587128-6587150 CCCTATAGCCCAAGGGTGGGTGG + Intronic
905409386 1:37757835-37757857 CCTTCTCCCTATAAGGTGGGAGG - Intronic
905465242 1:38148245-38148267 CCATCTAGCCATAAAGTGAGTGG + Intergenic
909399182 1:75207433-75207455 CCAACTAGCCAGCAGGTGGGTGG - Intronic
912707737 1:111927416-111927438 GCTTATAGCCAAAAAGAGGGAGG - Intronic
913992469 1:143627490-143627512 CCATCTAGAAACAAGGTGGGAGG - Intergenic
917541264 1:175916920-175916942 CTTTCTAGCTAAATGGTGTGTGG + Intergenic
920197450 1:204238512-204238534 CCATCTAGCCATAAAGTGGGTGG + Intronic
920223682 1:204423096-204423118 CTTCCTCGCCAAAAGGAGGGAGG - Exonic
924486321 1:244487281-244487303 CCTTCTAGTCACCTGGTGGGTGG + Intronic
1062909584 10:1204149-1204171 CTGTCTTGTCAAAAGGTGGGAGG - Intronic
1066676646 10:37894444-37894466 TCTTCTAGCCAAAGGGCTGGAGG + Intergenic
1067560451 10:47301059-47301081 TCTTCTAGCCAACGGGTGAGTGG + Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1082085057 11:48043453-48043475 CCCTCTAGCCAAGAGGTTGCTGG - Intronic
1084951981 11:72671503-72671525 GGATCTAGCCAAATGGTGGGGGG - Intronic
1089621582 11:119725787-119725809 CTTTCCAGACAAAAGGTGTGGGG + Intronic
1090304555 11:125679666-125679688 AATTCTAGCCAAAAGCTGAGAGG + Intronic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1097474073 12:60032592-60032614 TCTTCTAGCTAAAGGGTTGGTGG - Intergenic
1100315165 12:93438561-93438583 CCTTATAGCTAAGGGGTGGGGGG + Intronic
1101523865 12:105509754-105509776 ACTTCTATCCAAAAGGAGGTTGG + Intergenic
1101837778 12:108307173-108307195 CATTGTAGCCAAAGGGTGGCTGG + Intronic
1103437442 12:120937701-120937723 CCTCCTTGCCTCAAGGTGGGAGG + Intergenic
1105392681 13:19995677-19995699 CCTTCAAAAAAAAAGGTGGGGGG - Intronic
1107052245 13:36063617-36063639 CCATCTAGCAAAAAGGTGAGTGG - Intronic
1117528692 14:56637855-56637877 CCTGCTATCAAAAAGGTGGCAGG + Intronic
1121629295 14:95410866-95410888 CCTCCTTACCAATAGGTGGGGGG + Intronic
1125530059 15:40407200-40407222 CCTTTTAGCCAAAGGTTCGGGGG + Intronic
1128311507 15:66634014-66634036 CCTTATAGCCAGGAGGCGGGAGG - Intronic
1131190897 15:90315780-90315802 CCTTCTTGCCAAGAGGAGGAAGG + Intergenic
1135776907 16:25264815-25264837 CCTGCTGGCCAAAAGGCTGGTGG - Intergenic
1136752066 16:32649284-32649306 CCTTGTAGTCAAAGGGTTGGAGG - Intergenic
1137592983 16:49705086-49705108 CTTTCTGGGAAAAAGGTGGGAGG + Intronic
1146305569 17:31727449-31727471 CAACCTAGCCAAAAAGTGGGAGG + Intergenic
1149749709 17:59133805-59133827 CTTTATAGCCAAAACTTGGGGGG + Intronic
1157187557 18:45553386-45553408 CCTTCTAGCAGAGAGGTTGGAGG - Intronic
1159769913 18:72537644-72537666 CCTCCCAGCCACATGGTGGGGGG + Exonic
1160606034 18:80050055-80050077 CCTTCTGGACAAAAGGAGTGGGG - Intronic
1162331694 19:10033742-10033764 GTTTATAGCCACAAGGTGGGGGG + Intergenic
1166060361 19:40321867-40321889 CCTTCTAGCCCACCTGTGGGCGG - Exonic
1168141521 19:54391133-54391155 CCTTCCAGCACTAAGGTGGGTGG - Intergenic
1168156909 19:54478895-54478917 CCTTGAAGCCCCAAGGTGGGTGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
927719463 2:25373437-25373459 CCTTCAGGCCGGAAGGTGGGGGG + Intergenic
929922882 2:46185047-46185069 CCTTCTGGTCACCAGGTGGGAGG - Exonic
930436203 2:51346388-51346410 CGTTCTAGCCAGAAGCTGAGTGG - Intergenic
931200236 2:60090629-60090651 CTTTCATGCCAAAAGGTGGAAGG - Intergenic
931592893 2:63905282-63905304 ACTTCTAGCCAGAAAGGGGGAGG + Intronic
934079906 2:88458855-88458877 CCTTCTGGCCCTGAGGTGGGAGG - Intergenic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
940484976 2:154287074-154287096 GCTGCTTGCCCAAAGGTGGGTGG - Intronic
941942610 2:171059058-171059080 CCTTCTTGGAACAAGGTGGGGGG + Intronic
942680509 2:178473750-178473772 ACTTCTAGGCAAAATGTTGGAGG - Intronic
947223462 2:227817853-227817875 CCCTGTAGTCAAAAGGTGTGTGG - Intergenic
1170643320 20:18175333-18175355 CCTTCCAGCCAATACGTGGCTGG + Intronic
1175188830 20:57197987-57198009 CCTTAAGGCCACAAGGTGGGAGG + Intronic
1175399341 20:58692100-58692122 CCTTCTTGCAAAGGGGTGGGCGG + Intronic
1177894992 21:26846528-26846550 TCTTCTCTCCAAAAAGTGGGAGG + Intergenic
1183074134 22:35415990-35416012 GGTAGTAGCCAAAAGGTGGGTGG + Intronic
1183498883 22:38166261-38166283 CTTTCCAGCCAAAGGGAGGGTGG - Intronic
949624151 3:5848950-5848972 CCTTCTTCCCATGAGGTGGGAGG - Intergenic
950491448 3:13307543-13307565 AGTTCTAGCCAGAATGTGGGAGG - Intergenic
952032083 3:29155376-29155398 CCTTCTACCCAAAGGGGGTGGGG - Intergenic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
961710967 3:128827897-128827919 CCATCTACCCATAAAGTGGGAGG - Intergenic
962069176 3:132015367-132015389 CCTTCTAGCAGAAAGGAAGGGGG - Intronic
962347455 3:134628611-134628633 CATTCTATCAAAAAGGTAGGTGG - Intronic
967252259 3:187552466-187552488 CCTTCTAGCTTAATGGTGGATGG + Intergenic
968589897 4:1452131-1452153 CCTTCTCTCCAAAAGAAGGGGGG - Intergenic
970327659 4:14944148-14944170 CCTTCTTTGTAAAAGGTGGGTGG - Intergenic
971946406 4:33284731-33284753 CCTTTTTGCCAAAAGATGTGAGG - Intergenic
972716891 4:41655691-41655713 CATTCTCTACAAAAGGTGGGGGG - Intronic
977898717 4:102394706-102394728 CCATCTAGCCATAAAGTAGGTGG + Intronic
980387931 4:132111063-132111085 CCATCTAGCCATAAAGTGGGTGG - Intergenic
980602218 4:135040138-135040160 CCATCTAGCCTTAAAGTGGGTGG + Intergenic
981504872 4:145488580-145488602 ACTTCAAGAAAAAAGGTGGGGGG + Intronic
982244758 4:153340547-153340569 CCACCTAGCCAAAAGGCTGGTGG - Intergenic
994436681 5:99743746-99743768 CCTTCCAACCAAAACGTGGAAGG + Intergenic
997204108 5:132031586-132031608 CCTTCTGGCCAAGAAGGGGGAGG - Intergenic
997436181 5:133877381-133877403 CTGTCTACCCCAAAGGTGGGAGG + Intergenic
1001696609 5:173674928-173674950 CCTGCTAGCCAGAAGGAAGGGGG - Intergenic
1001858924 5:175036321-175036343 CCTTGAAGCCACAAGGTGGCAGG + Intergenic
1003005820 6:2380553-2380575 ACTACTAACTAAAAGGTGGGAGG + Intergenic
1005321049 6:24654708-24654730 GCTTCTAGCTAAAATTTGGGAGG - Intronic
1006080298 6:31561376-31561398 ACGTCTGTCCAAAAGGTGGGTGG + Intergenic
1010323594 6:74540609-74540631 CCATCTAGCCATCAGGTGGGTGG + Intergenic
1011038211 6:83000771-83000793 GCTTCTAGGCAAGGGGTGGGAGG - Intronic
1012818880 6:104059573-104059595 CCTTCATGCCAACAGGTGGATGG + Intergenic
1014176845 6:118340869-118340891 CCTGCAAGCCAGAAGGGGGGTGG - Intergenic
1016694216 6:146973981-146974003 CCTTCTTGCCAAAAGGAATGCGG + Intergenic
1017162059 6:151374354-151374376 CCTTCTAGCCAAAAGGTGGGAGG + Intronic
1021988828 7:26123042-26123064 CCATCTAGCCATAAAGTGGGTGG + Intergenic
1022283549 7:28933945-28933967 ACTTCCAGCTAAAAGGTTGGAGG + Intergenic
1024457206 7:49622354-49622376 TCCTCTAGGCAAATGGTGGGTGG - Intergenic
1026876430 7:73881664-73881686 CCTCCAAGCCCCAAGGTGGGGGG + Intergenic
1028788182 7:94820650-94820672 CCTACAAGCCAAAAGGTAGTGGG - Intergenic
1032515193 7:132501651-132501673 CCTGCTGGCCAAAAAGAGGGAGG + Intronic
1032923459 7:136575997-136576019 TCATCTAGCCATAAAGTGGGTGG - Intergenic
1033516532 7:142112187-142112209 CCTTCCTGCCCAAAGCTGGGAGG - Intronic
1034740350 7:153467653-153467675 CCTTCTAGCCACATGGTGAGAGG + Intergenic
1039571766 8:38592697-38592719 CCTTCTGGCCAGAACCTGGGGGG + Intergenic
1040812928 8:51476620-51476642 CATTCTTGCCAAAAGATGCGTGG + Intronic
1041006875 8:53504042-53504064 CATTCTAGCCTAAAGGGGTGGGG + Intergenic
1045472243 8:102522956-102522978 CCTTCTGGCCACAAGTGGGGTGG - Intergenic
1045481640 8:102597382-102597404 CCATCTCGAAAAAAGGTGGGGGG + Intergenic
1048664038 8:136641150-136641172 CCTTCTAGCTACAAGGGAGGAGG + Intergenic
1049773072 8:144392683-144392705 CCTTATGGCTAAAAGGTCGGTGG + Exonic
1051287780 9:15513714-15513736 CTTTCAAGCCCAAAGGTGGAAGG - Intergenic
1052129380 9:24823238-24823260 CATTTTAACCAAAAGCTGGGGGG + Intergenic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1053529649 9:38867453-38867475 CCCAGTAGCCAAAAGGTGGAAGG + Intergenic
1054201874 9:62091880-62091902 CCCAGTAGCCAAAAGGTGGAAGG + Intergenic
1054636483 9:67496479-67496501 CCCAGTAGCCAAAAGGTGGAAGG - Intergenic
1056482604 9:87020892-87020914 CTTTCTAGCTAAAATTTGGGAGG + Intergenic
1059627420 9:116081973-116081995 CCTTCCTGCCAAAATGTGGCAGG - Intergenic
1060506334 9:124200945-124200967 CTTTCTGGCCACAAGGAGGGAGG - Intergenic
1061796470 9:133088380-133088402 CCCTCCAGCCTACAGGTGGGAGG + Intergenic
1062324637 9:136006131-136006153 CCTGCCACCCAAAAGGTGCGTGG - Intergenic
1186187417 X:7035132-7035154 ACTTCTATACAGAAGGTGGGTGG - Intergenic
1197898478 X:131342570-131342592 CCTTGTAGCCAATAGGCTGGAGG - Intronic
1198555999 X:137793779-137793801 CCTACAAGCCAGAAGATGGGGGG + Intergenic
1199991934 X:152992373-152992395 CGTACTAGCAAAAAGGAGGGTGG + Intronic