ID: 1017173406

View in Genome Browser
Species Human (GRCh38)
Location 6:151478935-151478957
Sequence GGGAAATGGTTTTTGTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017173403_1017173406 -3 Left 1017173403 6:151478915-151478937 CCAGTGAGTAAGATTTTGGAGGG No data
Right 1017173406 6:151478935-151478957 GGGAAATGGTTTTTGTGAACAGG No data
1017173399_1017173406 15 Left 1017173399 6:151478897-151478919 CCACCAAGCAGCTGGAAGCCAGT No data
Right 1017173406 6:151478935-151478957 GGGAAATGGTTTTTGTGAACAGG No data
1017173400_1017173406 12 Left 1017173400 6:151478900-151478922 CCAAGCAGCTGGAAGCCAGTGAG No data
Right 1017173406 6:151478935-151478957 GGGAAATGGTTTTTGTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017173406 Original CRISPR GGGAAATGGTTTTTGTGAAC AGG Intergenic
No off target data available for this crispr