ID: 1017174959

View in Genome Browser
Species Human (GRCh38)
Location 6:151494101-151494123
Sequence CCGAGCGCGCCCCCGGGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017174940_1017174959 23 Left 1017174940 6:151494055-151494077 CCCGCCGGCTCCCGGCGCCGCCG 0: 1
1: 2
2: 9
3: 74
4: 545
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174942_1017174959 19 Left 1017174942 6:151494059-151494081 CCGGCTCCCGGCGCCGCCGCTTC 0: 1
1: 0
2: 8
3: 67
4: 587
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174943_1017174959 13 Left 1017174943 6:151494065-151494087 CCCGGCGCCGCCGCTTCCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 252
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174949_1017174959 3 Left 1017174949 6:151494075-151494097 CCGCTTCCTCAGGGCCGGTTCCG 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174941_1017174959 22 Left 1017174941 6:151494056-151494078 CCGCCGGCTCCCGGCGCCGCCGC 0: 1
1: 2
2: 23
3: 184
4: 957
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174945_1017174959 12 Left 1017174945 6:151494066-151494088 CCGGCGCCGCCGCTTCCTCAGGG 0: 1
1: 0
2: 1
3: 21
4: 251
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174952_1017174959 -3 Left 1017174952 6:151494081-151494103 CCTCAGGGCCGGTTCCGGGTCCG 0: 1
1: 0
2: 1
3: 9
4: 82
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174939_1017174959 26 Left 1017174939 6:151494052-151494074 CCACCCGCCGGCTCCCGGCGCCG 0: 1
1: 0
2: 11
3: 71
4: 571
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174
1017174948_1017174959 6 Left 1017174948 6:151494072-151494094 CCGCCGCTTCCTCAGGGCCGGTT 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG 0: 1
1: 0
2: 3
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017174959 Original CRISPR CCGAGCGCGCCCCCGGGCTC GGG Exonic
902336954 1:15759266-15759288 CCTGGAGCGCCCCCGGGCTCCGG - Intronic
902813419 1:18902412-18902434 CCGAGCGCGCGCCTGGGGCCCGG - Intronic
902823183 1:18955962-18955984 CCGTGCCCGCCGCCGGGCGCCGG + Exonic
904267344 1:29325482-29325504 CCGAGGGCGGGCCTGGGCTCGGG + Intronic
905137025 1:35808056-35808078 GCGTGCGCGGCCCCGGGCGCGGG - Intergenic
905846985 1:41241836-41241858 CAGAGCCGGCCTCCGGGCTCGGG + Intronic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
915445513 1:155972389-155972411 CTGTGCCCGCCCCAGGGCTCAGG + Intronic
917565403 1:176207351-176207373 CAGGGCGCGCCCTCGGGGTCGGG + Exonic
919892087 1:201982881-201982903 CCGAGGGCGCCGCCGAGCTGCGG + Exonic
920389802 1:205592300-205592322 TAGAGCGCGCCTCCTGGCTCGGG - Intronic
921671107 1:217925064-217925086 CCGAGCGCGCCCAGGGCCTGGGG - Intergenic
922526498 1:226308683-226308705 CCGAGCCCTCCCCCGGCCCCGGG + Intronic
924188252 1:241519376-241519398 CCAAGCGCTCTCCCGGGCTGCGG + Intronic
1066548191 10:36524408-36524430 CCCAGCGGACTCCCGGGCTCCGG - Intergenic
1067096548 10:43305064-43305086 CCGCCCCCGCCCCCGGGATCGGG + Intergenic
1070032641 10:72692306-72692328 GCGAGCGCGCCCGGAGGCTCCGG + Intronic
1073306048 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG + Exonic
1074864648 10:117537683-117537705 CCCAGCGCTCCCCCGCCCTCGGG + Intergenic
1075420156 10:122294724-122294746 CCGGGCTCGCCTCTGGGCTCAGG - Intronic
1075580636 10:123615342-123615364 CCTAGATCGCCCCTGGGCTCAGG + Intergenic
1076889490 10:133276797-133276819 CCATGCGCGGCCTCGGGCTCTGG - Exonic
1076919993 10:133446351-133446373 CCCACCGCGCCCCCCGCCTCGGG + Intergenic
1077360956 11:2139875-2139897 CTGAGGGGGCCCCTGGGCTCGGG + Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081812815 11:45922891-45922913 CCGAGGGCGCCCCCGGGCGCTGG + Exonic
1083436421 11:62646530-62646552 CCGGGCGCGCCCCCAGATTCCGG + Intronic
1083658711 11:64242226-64242248 CCGCCCTCTCCCCCGGGCTCCGG - Intronic
1083883269 11:65558560-65558582 CCCAGCGCGGCCGCGGGTTCCGG - Intronic
1084069933 11:66727780-66727802 CCGAGCGCGCCCCCAGCACCTGG + Intronic
1085173472 11:74467529-74467551 CCCAGCGCGCTCTCTGGCTCTGG + Exonic
1087761983 11:102111211-102111233 CCGAGCGCCCCCCCGGTCTGAGG - Intronic
1089274912 11:117328171-117328193 CTGAGCGGGCCACCGGGCCCGGG + Intronic
1090285602 11:125496308-125496330 CCGCGCTCGTGCCCGGGCTCCGG + Exonic
1090285610 11:125496327-125496349 CCGGGGGCGCGCCCGCGCTCGGG + Intronic
1091221285 11:133931350-133931372 CCCAGCGAGCCCCGGGGCTGAGG - Intronic
1091718334 12:2795312-2795334 CCGTGCCCGGCCGCGGGCTCCGG - Intronic
1092256340 12:6928332-6928354 CCGAGCGGGATTCCGGGCTCCGG - Intronic
1094155376 12:27332906-27332928 CCGTGCGCGCCTACGGGCTGCGG + Intronic
1095800918 12:46269257-46269279 CCGAACACGCCGCCGGGCCCCGG - Intronic
1096781414 12:53994404-53994426 CAGAGCGGGCTCCCGGGCTGTGG + Intronic
1096813760 12:54188728-54188750 CCGGGGGCGCCCGCTGGCTCCGG + Intronic
1101493938 12:105236073-105236095 CCGAGAGCACTCCCCGGCTCTGG + Exonic
1102679960 12:114684630-114684652 CGGAGAGCGCGCCCGGGCGCCGG + Intergenic
1104376551 12:128268454-128268476 CTGGGCGCGCCCCGGGACTCGGG - Intronic
1105690937 13:22838436-22838458 CGGAGCGCGGCTCCCGGCTCCGG + Intergenic
1106157292 13:27171175-27171197 CAGAGCGCGGCCCCGGGCCGGGG - Intronic
1106304090 13:28495031-28495053 CGGAGCGGGCTCCGGGGCTCGGG - Exonic
1106340349 13:28820701-28820723 GGGAGCGCGCAGCCGGGCTCGGG + Intronic
1112504630 13:99968609-99968631 CCGCGCGCGGCCCCGCGCTTGGG + Intronic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1112752559 13:102597223-102597245 CCGCCCGCGCCCCCGCGCCCGGG - Intronic
1114659305 14:24334665-24334687 CCTAGCCAGCCCCGGGGCTCGGG - Exonic
1114736712 14:25049959-25049981 CCGCGCGGGGCTCCGGGCTCCGG + Exonic
1114989056 14:28264440-28264462 CCGGGAGCGCCCCCGGGCCGCGG + Intergenic
1116928630 14:50668104-50668126 CTGCGGGCGACCCCGGGCTCCGG - Exonic
1118777174 14:68979998-68980020 TCTAGCTCGCCCTCGGGCTCTGG + Intergenic
1119742954 14:77026219-77026241 CCCAGCGCACCCCCGGGGACCGG - Exonic
1121211050 14:92208081-92208103 CCGGGAACGCCCCAGGGCTCTGG + Intergenic
1121711015 14:96039311-96039333 CCCCGCCCGCCCCCGCGCTCGGG + Exonic
1121751739 14:96363377-96363399 CCCGGCGCGCCGCCGGGCGCTGG + Exonic
1122270798 14:100567789-100567811 CCGAGGCCGCCCGCGGGCCCTGG + Intronic
1122771384 14:104099449-104099471 CCAAGCCCGCCCCCTGGCCCTGG + Intronic
1122779125 14:104136274-104136296 CGCCGCGCGCCCCCGCGCTCCGG - Intergenic
1122960376 14:105091397-105091419 CCCAGAGCGCCCCGGGGGTCGGG + Intergenic
1122975105 14:105167813-105167835 CCGAGCGCGGGCGCGGGCCCGGG - Exonic
1124469347 15:29969035-29969057 CGGAGCGCGCCGCCGGGCCACGG - Intergenic
1124629460 15:31328225-31328247 CTGAGCGCGCGCCCGGGCAGCGG - Intronic
1127342863 15:58065710-58065732 GCGAGCGCGCCCCCGGGCCGCGG - Exonic
1128758687 15:70199998-70200020 CCCAGAGAGCCCCCGGGCTGTGG + Intergenic
1129539325 15:76338095-76338117 CGCAGCGCTCCCCCGGGCCCGGG + Intronic
1131097481 15:89665746-89665768 CCCGGCGCGCCCCCCGGCCCGGG - Exonic
1132527869 16:426321-426343 CGGAGCGCGGCCCTGGGCCCGGG - Exonic
1132591156 16:727043-727065 CTGAGCGCGGCGCTGGGCTCGGG - Intronic
1132591399 16:727851-727873 CCCGGCGCTCCCCGGGGCTCTGG + Intronic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1134156879 16:11851320-11851342 CCGAGCACGCACTCGGGTTCCGG + Intronic
1135407018 16:22206160-22206182 CCTAGCGGGCCTCCTGGCTCCGG - Intergenic
1135691422 16:24540236-24540258 CCGAGCGACCCCACGGGGTCAGG - Exonic
1136110971 16:28063512-28063534 CCCGCCGCGCCCCGGGGCTCGGG + Intergenic
1138178787 16:54929046-54929068 CTGCGCGCTCCCCCAGGCTCGGG + Intergenic
1139510094 16:67422712-67422734 CCTTGCGTGCCCCCTGGCTCAGG + Intergenic
1139582313 16:67880819-67880841 CCGAGCTCGGCCCCCAGCTCGGG + Exonic
1140442609 16:74999223-74999245 CCGGGCGCGTCCCCCGCCTCAGG - Exonic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1142156205 16:88533861-88533883 CCGCGCTCGTCCCCGGGCCCCGG + Exonic
1142393432 16:89816967-89816989 CCGCGCGCGCCTCTGAGCTCCGG + Intergenic
1144020926 17:11240179-11240201 CAGCGCGCTGCCCCGGGCTCCGG + Intergenic
1144724498 17:17495031-17495053 CCGCGCGCGCTCCCGGCCTGGGG + Exonic
1145049509 17:19648584-19648606 CCGAGCGCGGCCACGGGCCAGGG - Intronic
1147006417 17:37407167-37407189 CGGGGCGGGCCCCCGGGGTCAGG - Intronic
1147608309 17:41786447-41786469 CCCAGCGCGCCCCCTGCCGCCGG + Intronic
1148323618 17:46771452-46771474 CCCAGCGCGGCCCGGGGCCCGGG - Intronic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1150488528 17:65560098-65560120 CCGACCCCCCGCCCGGGCTCGGG - Intronic
1151591393 17:75047102-75047124 CCGCGCGGGTCCCCGGGCGCTGG + Intronic
1152136118 17:78504712-78504734 GCAAGCGCGTCCCCCGGCTCAGG - Intronic
1152407783 17:80107471-80107493 CAGAGAGCACCCCCGGGCCCTGG - Intergenic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1154501079 18:14998342-14998364 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1159241702 18:65750816-65750838 CCGCGCGCTCCCGCTGGCTCCGG + Intronic
1160436597 18:78856848-78856870 CCCAGCGCGTCCCCAGGCTCCGG - Intergenic
1160696109 19:485326-485348 CCCAGGGCGCCACGGGGCTCGGG - Intergenic
1161013170 19:1969862-1969884 CCGAGCTGGTCCCCGAGCTCCGG - Exonic
1161485813 19:4535118-4535140 GGGAGCGCCCCCCCGGGCTTAGG - Intronic
1162760544 19:12885955-12885977 TGGGGCGCGCCACCGGGCTCCGG + Exonic
1162770418 19:12946033-12946055 TCGCTCCCGCCCCCGGGCTCCGG - Intronic
1162944160 19:14032150-14032172 CCCACCCCGCCCCGGGGCTCCGG - Intronic
1163085874 19:14979580-14979602 CCGGGCGCTTCGCCGGGCTCCGG - Intronic
1163220030 19:15912025-15912047 CTGAGCGCGGCTCCCGGCTCAGG + Intergenic
1163715479 19:18870140-18870162 CCCAGGGTGCCCCCAGGCTCCGG - Exonic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1165745735 19:38228863-38228885 CCGGGAGCGCCCTCGGTCTCCGG - Intronic
1166108599 19:40609840-40609862 CCGAGCCGGCCCACGGGCTGCGG + Exonic
1166791726 19:45402733-45402755 CCGAGCTCTCCCGCGGGCTCTGG + Intronic
1168536023 19:57171917-57171939 CCGCTCGCGCCCCCCGGCCCGGG - Intergenic
924987713 2:287550-287572 CCGAGCGCGCCCGAGGGCCGGGG - Intronic
925029265 2:636722-636744 CCCGGCGCGCCCAGGGGCTCAGG + Intergenic
925376228 2:3388116-3388138 CAGCGCGCGCCCCCAGCCTCCGG + Exonic
928181287 2:29070792-29070814 CCGAGAGGGCCCCCAGCCTCTGG + Exonic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
930096462 2:47570347-47570369 CCGAGCGCCGCCCCGGCCCCGGG - Exonic
931253868 2:60554206-60554228 CCGAGCGCAGCCGCGGGCTCGGG - Intergenic
931429648 2:62197755-62197777 CCGAGCCAGTCCCGGGGCTCCGG + Intronic
932731848 2:74227162-74227184 CCCAGCGGGCCCTCGGGGTCTGG - Intronic
934846395 2:97663787-97663809 CCGCGTGCGCCCCCGGGGGCGGG + Intronic
935275812 2:101474436-101474458 CCTTCCGCGCCCCCGGGCTCGGG - Intronic
935592727 2:104856210-104856232 CTGAGCGCGCCACCGGGGCCCGG + Exonic
935641882 2:105298656-105298678 CCCAGCGCGCCCCCGTGCACTGG - Exonic
937221760 2:120346116-120346138 CCGAGCGCAGGGCCGGGCTCCGG - Intergenic
938500247 2:131828531-131828553 CCGAGCGCGCACCAGGGCCTGGG - Intergenic
942046634 2:172102779-172102801 CCCAGCGCGAGCGCGGGCTCTGG + Exonic
944495862 2:200306861-200306883 GCGACCGCGCCCCCGGGCCCCGG + Intronic
945780550 2:214166405-214166427 CCCTCCACGCCCCCGGGCTCGGG + Intronic
947399211 2:229714873-229714895 CCGAGTGCGCCCCAAGGCCCGGG + Intergenic
947992213 2:234496889-234496911 CGGGCCGCGCCCCCGCGCTCCGG + Exonic
948205977 2:236163240-236163262 TCGGGGGCGCCCCGGGGCTCAGG + Intergenic
1169143606 20:3239065-3239087 CCCGCCGCGCCCCCGGGTTCAGG + Intronic
1169383323 20:5127256-5127278 CCGACGGCGGCCCCGGGCCCGGG + Intronic
1175429597 20:58891935-58891957 CCGAGCCCGCCCCCCGCCCCGGG + Intronic
1175624061 20:60475827-60475849 CTTAGGGCTCCCCCGGGCTCAGG - Intergenic
1175840219 20:62021946-62021968 CGGAGCGCCCTCCCGGGCTTTGG - Intronic
1176014887 20:62926059-62926081 GCGAGTGCGGCCCGGGGCTCGGG - Intronic
1176118035 20:63441692-63441714 CTGAGCGTGCCCCGGGGCCCAGG - Intronic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1180158703 21:45989675-45989697 CTGAGGGCACCACCGGGCTCGGG - Intronic
1180950538 22:19718703-19718725 CCGAGCGTGCCCCCGGGCCTGGG + Intronic
1181934572 22:26429465-26429487 CCGTCCGCGCGCCCGGGCGCAGG + Exonic
1183831137 22:40418889-40418911 CCGCCCGCCCCCCAGGGCTCAGG + Exonic
1183994219 22:41620943-41620965 CCGAGCCCGGGCCCGGGCTGAGG + Exonic
950015148 3:9749995-9750017 CTGTGCGCGCCCACAGGCTCTGG + Exonic
955228328 3:57078975-57078997 CCCAGTGCGCCCCCGTGCGCTGG + Intronic
956080247 3:65549450-65549472 CCGAGCGCGCGCCTGGGCTCCGG - Intronic
961446225 3:126983013-126983035 CCCGCCCCGCCCCCGGGCTCTGG + Intergenic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
968652881 4:1767100-1767122 CCGGGCGCGCCTCTGGGCTTGGG - Intergenic
968766089 4:2469819-2469841 CCGGGCGCGCTTCCGGGCCCCGG + Intronic
973230789 4:47837306-47837328 CCAAGCGCGAGCCCGGGCTGTGG + Intronic
976751831 4:88457189-88457211 CTGAGCGCGCCCACTGCCTCAGG - Exonic
983577080 4:169271221-169271243 CCAATCCCGCCCCCGGGCTCCGG - Intergenic
985445547 4:190019379-190019401 CCGAGCGTGCCCACGGGCCCCGG - Intergenic
985535804 5:465185-465207 CCTTGCGCTCCTCCGGGCTCCGG - Exonic
997301995 5:132813383-132813405 CCCAGCGCCCCGCCGGGCCCCGG - Intergenic
998583227 5:143402750-143402772 CCGAGCGCGAGCCCGGGCTCCGG - Intronic
1000071412 5:157743982-157744004 CGGGGCGCGGCCGCGGGCTCTGG + Exonic
1001680773 5:173555391-173555413 CCGATGGCGCCCGCGGGCTGCGG - Intergenic
1003049469 6:2766240-2766262 CCGCCCGCACCCCCGGGCGCTGG + Exonic
1003366605 6:5481197-5481219 CGGAGGGCTCCCCTGGGCTCTGG - Intronic
1003573042 6:7268532-7268554 CCGAGCGCTCCCCGTGCCTCAGG + Intronic
1003995572 6:11537397-11537419 CAGGGCGCGCGCCCGGGGTCCGG + Intergenic
1006472786 6:34237693-34237715 CCGAGCCCGAGCCCGGGCCCGGG + Intronic
1007406509 6:41638804-41638826 CCCAGCGCAGCCCCGGGCCCAGG + Exonic
1007424022 6:41735375-41735397 CCGCCCGCGCCCCGCGGCTCCGG + Intronic
1007429175 6:41766879-41766901 CAGAGAGCGCCCCAGAGCTCAGG + Intergenic
1007656856 6:43455674-43455696 CCCGGCGCGCCCCGGGGCCCCGG + Intronic
1016936130 6:149450694-149450716 CCAGGGGCGCCCCCGCGCTCTGG + Exonic
1017174959 6:151494101-151494123 CCGAGCGCGCCCCCGGGCTCGGG + Exonic
1019457498 7:1138113-1138135 GGGAGCCCGCCCCGGGGCTCTGG + Exonic
1019635765 7:2074829-2074851 CCGAGGGCCCCCCCAGCCTCCGG - Intronic
1029535413 7:101154764-101154786 CAGAGCGCCCCTCCCGGCTCGGG - Intronic
1037281463 8:17246902-17246924 CGGAGAGCGCCCCCGGGGGCGGG + Exonic
1039467994 8:37797353-37797375 CCGGGCGCGCCCCGAGCCTCGGG - Exonic
1043391578 8:79797079-79797101 CCGGGCATGCCCCCGGGTTCAGG + Intergenic
1044666709 8:94640344-94640366 ACGAGCGTGCACCCGGGCTCCGG + Intergenic
1047202904 8:122781589-122781611 CCGAGCTGCCACCCGGGCTCGGG - Exonic
1047615277 8:126557993-126558015 CCGCGCCCGCCCTCAGGCTCGGG + Intronic
1049672522 8:143876304-143876326 CCGGGCGCGCCTGCTGGCTCAGG - Intronic
1050546775 9:6716155-6716177 CCCAGCGCGCATCCGGGCTCCGG - Intergenic
1057225293 9:93289665-93289687 CCGGGCCTGCGCCCGGGCTCCGG - Intronic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1061296759 9:129681103-129681125 CTGAGCCAGTCCCCGGGCTCCGG + Intronic
1062360544 9:136185957-136185979 CAGAGCTCGCCTCTGGGCTCTGG - Intergenic
1062651362 9:137579355-137579377 CAGAGCGCGCCTGCGGCCTCGGG - Intergenic
1185467667 X:364221-364243 CCCAGCGCGCCTCCGGCCCCAGG + Intronic
1199760116 X:150898700-150898722 CCGCGCGCGCGCGCGGGCTTTGG - Exonic