ID: 1017174988

View in Genome Browser
Species Human (GRCh38)
Location 6:151494205-151494227
Sequence CCGCGCGCGGGGGTGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017174975_1017174988 1 Left 1017174975 6:151494181-151494203 CCGAGGTACGGTCCCAGCCGCCG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 159
1017174971_1017174988 16 Left 1017174971 6:151494166-151494188 CCGCTTCGCCAGCGCCCGAGGTA 0: 1
1: 0
2: 0
3: 0
4: 28
Right 1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 159
1017174973_1017174988 8 Left 1017174973 6:151494174-151494196 CCAGCGCCCGAGGTACGGTCCCA 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 159
1017174974_1017174988 2 Left 1017174974 6:151494180-151494202 CCCGAGGTACGGTCCCAGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG 0: 1
1: 0
2: 0
3: 18
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017174988 Original CRISPR CCGCGCGCGGGGGTGGCCCT GGG Intronic
900146410 1:1160756-1160778 CCGCTCCTGAGGGTGGCCCTGGG - Intergenic
900166678 1:1246770-1246792 CCGCGCGGGGGCGAGGCCCAGGG + Intergenic
900190081 1:1349520-1349542 CCGCGCGCGGGGGCGGGGCCGGG - Intergenic
901641264 1:10694263-10694285 GCGCGGGCGGGGGAGGCCCGGGG - Intronic
903642426 1:24869011-24869033 CCGGGCGCGGTGGTGGGCATAGG + Intergenic
904171107 1:28592657-28592679 CAGCGCGCGGCGGTAGCACTCGG - Intronic
904688276 1:32275694-32275716 CCGGGCGCGGGGGTGCCCCGGGG + Intronic
905449441 1:38047087-38047109 AGTGGCGCGGGGGTGGCCCTGGG + Intergenic
905862827 1:41362125-41362147 CCGCGCCCAGGGGCGGCGCTGGG - Exonic
906256521 1:44354978-44355000 CGGGGGGCGGGGGCGGCCCTGGG - Exonic
906949869 1:50326154-50326176 CGGGGCGAGGGGGAGGCCCTGGG + Intergenic
910257180 1:85259696-85259718 CCACGCGAGGGGCGGGCCCTGGG - Intergenic
914919555 1:151838246-151838268 CCGCGGCCGGGGCAGGCCCTCGG + Exonic
915595083 1:156892540-156892562 CCGCGGGAGGGTGTGACCCTGGG - Intergenic
920002331 1:202808253-202808275 CCGCGCCCGGCGCTGCCCCTCGG - Exonic
920394124 1:205631637-205631659 CCGCGCGCGGGGCTCCCCCTCGG + Exonic
921389897 1:214606745-214606767 CTGGGGGTGGGGGTGGCCCTGGG - Intronic
1066180477 10:32957563-32957585 CCGCCCGCGGCGCTGGCCCCAGG + Intronic
1066352000 10:34644373-34644395 CGGAGCGTGGGGCTGGCCCTTGG - Intronic
1067559749 10:47296618-47296640 CCGCGGCCTGGGGAGGCCCTGGG + Intergenic
1069695546 10:70382759-70382781 GCGCGCGCGGGGGTGGCGCGCGG + Intergenic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070827927 10:79401911-79401933 CCGGCCGCTGAGGTGGCCCTGGG + Intronic
1072021826 10:91410250-91410272 GCGCGCGCGGGGGCGGCCTCGGG + Intergenic
1072757282 10:98029887-98029909 CCGCGCGCGGGGCTGGCTCCCGG + Intronic
1072757636 10:98031074-98031096 CTGCGCGCAGGGGTGGCCGCGGG - Intergenic
1074086178 10:110210156-110210178 CCCCGCGCGGGGCGGGCCCGTGG + Intronic
1074130125 10:110566814-110566836 CAGCGGGCGGGGGTGGGGCTGGG + Intergenic
1074130420 10:110568258-110568280 CCCGGCCCGGGGGCGGCCCTGGG + Intronic
1077074931 11:696037-696059 CCGCGCGCGGGGGAGCTCTTCGG - Intronic
1077169640 11:1160488-1160510 CAGTGCGTGGGGGTGGCCCGTGG - Intronic
1077444074 11:2582249-2582271 CCCTGCCCGGGGGTGGCCATGGG + Intronic
1078057406 11:8019254-8019276 CCGCGGGCGGCGGCGGCGCTGGG - Intronic
1078429767 11:11280134-11280156 CCCCGGGCGGGGGGTGCCCTGGG - Intronic
1080283593 11:30585375-30585397 CGGCGCGCGCGGGCGGCCCCGGG + Intronic
1080779716 11:35419200-35419222 CCGCCCGCGGGGATGGCGCTTGG + Exonic
1081636890 11:44727343-44727365 CGGCGCGCGGGGGGGTCCCCAGG - Intronic
1082002386 11:47400284-47400306 CGGCGCGGGGGAGGGGCCCTAGG - Intergenic
1083823280 11:65184260-65184282 GCGCGGGTGGAGGTGGCCCTCGG + Intronic
1084056637 11:66638221-66638243 CCGCGAGGGGGGGTGGTGCTTGG + Intronic
1084888488 11:72225006-72225028 CCGGGCCCGGGGGGCGCCCTGGG + Exonic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1090190297 11:124762403-124762425 CCGCGCGCTGGGGGCGCCCCCGG - Intergenic
1091778649 12:3200402-3200424 CCGCGCGCCGGGGCAGCCCAGGG + Intronic
1096337059 12:50764412-50764434 TCGCGCGCGGTGGTGGCGGTGGG + Intronic
1096460724 12:51820429-51820451 CGGCGCGCGGGGGAGGCCGCGGG - Intergenic
1097648058 12:62260279-62260301 CCGGGAGCGGGGGTGCTCCTCGG - Intronic
1100186528 12:92145541-92145563 CGGCGTGCGGGGGCGGCCCGGGG + Exonic
1101131711 12:101697548-101697570 CCGCGCTCGCGGGTCACCCTCGG - Intronic
1103749961 12:123151518-123151540 CCGCGCCCGGGGCTGGGCTTCGG - Intergenic
1104580616 12:130008508-130008530 CAGCTGGAGGGGGTGGCCCTGGG - Intergenic
1105900054 13:24745977-24745999 CTGCGCGCCGGGGTGGCCCACGG - Intergenic
1111950815 13:94707702-94707724 TCGCGCGAGGGGGTGGCTTTGGG - Intergenic
1118725780 14:68628296-68628318 CCGCGCCCCGGGGCGGCCCGAGG - Intronic
1120935488 14:89891933-89891955 CAGCGCGCGGCGGTAGCACTCGG - Intronic
1121648154 14:95535142-95535164 GCGCGGGCGGCGGTGGCCTTTGG + Exonic
1122629815 14:103102501-103102523 CCGGGCGCGGGGTGGGCCTTCGG + Exonic
1122781389 14:104145314-104145336 CCGTGGGCTGGGGTGGCCCGAGG + Intronic
1123021074 14:105398266-105398288 GCGCGCGCGGAGGTGGCCCGGGG + Intergenic
1131085975 15:89575869-89575891 CCGTGCGTGTGGGTGGCCCTGGG - Exonic
1132649815 16:1015373-1015395 CTCCGTGCGGGGCTGGCCCTGGG + Intergenic
1133038094 16:3046019-3046041 CTGCGCGCGGGGCTCGGCCTGGG - Intergenic
1134070213 16:11255925-11255947 CCGCGCGCGGGGGGCGGCCTGGG + Intronic
1136111082 16:28063823-28063845 CCGGGCGCGGGCGGGGGCCTGGG + Intergenic
1136707446 16:32201644-32201666 CTGGGAGTGGGGGTGGCCCTGGG + Intergenic
1136760465 16:32727773-32727795 CTGGGAGTGGGGGTGGCCCTGGG - Intergenic
1136807638 16:33142613-33142635 CTGGGAGTGGGGGTGGCCCTGGG + Intergenic
1137614562 16:49838913-49838935 CGGCCCGCGGGGGCGGCCCCGGG - Intronic
1137788402 16:51154828-51154850 CCGCACCCGGGGGAGGCGCTTGG + Intergenic
1138528620 16:57622842-57622864 CAGCAGGCGGGGGTGGACCTTGG + Intronic
1138591064 16:58000175-58000197 CCGCCCTCGGGGCTCGCCCTCGG - Intronic
1139420152 16:66844853-66844875 CAGCGCGTGGGGGTGGCCCAGGG + Intronic
1141828582 16:86497397-86497419 CCGCGCGCGGGGCTCGGCCGAGG + Intergenic
1141889546 16:86917636-86917658 GCGGGCGCGCGGGTGGCGCTCGG + Intergenic
1142240395 16:88941962-88941984 CCACGCACGGAGGTGGCCCCGGG - Intronic
1142299251 16:89247214-89247236 CCCCGCTCGGGGGCGGCCCCTGG - Intergenic
1142347122 16:89561071-89561093 CTGCGCTCGGGGCTGCCCCTGGG + Intronic
1203062618 16_KI270728v1_random:988088-988110 CTGGGAGTGGGGGTGGCCCTGGG - Intergenic
1142518775 17:491112-491134 CAGCGCGCGGGGATCGGCCTCGG - Intergenic
1144339173 17:14298409-14298431 CCACGCGCGGCGGTCGCTCTCGG - Intergenic
1144756082 17:17681531-17681553 CCGCGGGCGGGGGCGGCGCCCGG - Exonic
1146398431 17:32486522-32486544 ACGCGGGCGGGGTCGGCCCTCGG + Intergenic
1147550657 17:41439190-41439212 CCACGAGCAGGTGTGGCCCTGGG - Exonic
1151293083 17:73164589-73164611 CTGCGCCCGGGGCTGGCCCACGG + Intergenic
1151682190 17:75628097-75628119 ACGGGCGTGGGGCTGGCCCTAGG + Intronic
1152066974 17:78117438-78117460 CCGCAGGTGGGGGCGGCCCTGGG - Intronic
1152357533 17:79814089-79814111 TGGCGCGTGGGGCTGGCCCTAGG - Intergenic
1152638165 17:81438674-81438696 CTGCGCCTGGGGGTGGTCCTGGG - Intronic
1152659689 17:81536545-81536567 CCGGGCGGGGTGGGGGCCCTGGG - Exonic
1153565609 18:6414727-6414749 CCCCGCGCGGCGGCGGCCGTGGG + Intronic
1153794448 18:8609629-8609651 CCGCGCGCGGCGGAGGCCGAGGG + Exonic
1160040463 18:75340339-75340361 CCTGGCGCGGCGGTGGCACTGGG - Intergenic
1160592585 18:79952397-79952419 CCGCGGGCGGGTGTGGGGCTCGG - Intergenic
1160764109 19:799498-799520 CAGCGCTGGGGGGTGGCCCCCGG - Intronic
1160873230 19:1286319-1286341 CCGCGCGCGGGGGGCGCCCGGGG + Intronic
1163437167 19:17302774-17302796 ACGGGGGCGGGGGTGGCCCAAGG - Intronic
1166083272 19:40458312-40458334 CCGGGGGCGGGGGTGGCGCTGGG + Intronic
1166304070 19:41927953-41927975 GCGGGCGCGGGGGTGGTCCCGGG - Intronic
1166330672 19:42076415-42076437 CCGCGCGCCGGGTCGGCCGTTGG - Intronic
1167239342 19:48333958-48333980 CCTCGCGGGGGTGTGGCCCCTGG + Intronic
1167709944 19:51104400-51104422 CCCGGCGCGGTGGTGGCCGTGGG - Exonic
1167780990 19:51598691-51598713 CCAGGCGCAGTGGTGGCCCTGGG + Intergenic
927552136 2:24010061-24010083 CCGCCCGCGGCCGTTGCCCTCGG - Exonic
929572645 2:43032323-43032345 CCAGGCCCGGGGGTGTCCCTGGG - Intergenic
935225246 2:101047155-101047177 CAGGGCGCAGGGGAGGCCCTGGG - Intronic
935595356 2:104873506-104873528 GCGCGCGCGGGGCTGGCCACAGG - Intergenic
936288321 2:111198876-111198898 CCGGGCTCGTGGCTGGCCCTGGG - Intergenic
937065085 2:119011655-119011677 CCGCGCTCGCGGGCGGCTCTGGG + Intergenic
937914063 2:127090339-127090361 CTGCCTGCGGGGGTGGCACTGGG - Intronic
946433449 2:219637684-219637706 CCTCGGGCTGGGGGGGCCCTCGG - Exonic
946689558 2:222300134-222300156 CAGAGCGCGGGGCTGGCACTCGG - Intronic
948874546 2:240819809-240819831 AGGCGGGCGGGGGTCGCCCTCGG - Intronic
1169048777 20:2558982-2559004 CCGCGCGGGGGAGTGGCCGCGGG + Intronic
1170578623 20:17681976-17681998 CCGCGCGCGGGCCGGGCCGTCGG - Intronic
1172252596 20:33490243-33490265 CGGCGCGCGGCGGCGGCGCTCGG + Intronic
1175333485 20:58179994-58180016 CCCCGCGCGTGGGTGGCCCCCGG + Intergenic
1175733508 20:61370169-61370191 CCCCGAGGGTGGGTGGCCCTGGG + Intronic
1175921237 20:62451444-62451466 CCGGGCGCGGTGGGGGGCCTAGG - Intergenic
1178707679 21:34888946-34888968 CCGCACGCGGGCGGGGCCCCGGG - Intronic
1179445389 21:41426873-41426895 CCACGCGCCGGGGAGGCCCCAGG - Intronic
1179935758 21:44602511-44602533 CCGCTGGCCGGGCTGGCCCTTGG + Intronic
1179961220 21:44767885-44767907 CCGCTGGCCGGGCTGGCCCTTGG + Intergenic
1180093225 21:45542913-45542935 GCGCCCTCAGGGGTGGCCCTGGG + Intronic
1180707466 22:17818259-17818281 CCTCGCCCGGGGGTGGCGGTGGG + Exonic
1181532097 22:23522680-23522702 CCGGGCGCGGGGGTCTCCCCCGG + Intergenic
1184527846 22:45036040-45036062 CCCTGGGCGGGTGTGGCCCTTGG - Intergenic
950421007 3:12899475-12899497 CCGCGTGCAGGTCTGGCCCTGGG + Intronic
954540839 3:51392119-51392141 CGGCGGGCGCGGGCGGCCCTGGG - Exonic
963885975 3:150582741-150582763 CAGTGTGCTGGGGTGGCCCTGGG + Intronic
966712012 3:182980695-182980717 CCGGGCGCGGGGGTCCCCCGGGG + Intronic
968491038 4:890559-890581 CCACGGGAGGGGGTGGCCCTCGG + Exonic
976751875 4:88457385-88457407 CAGCGCGCGGTGGAGGCCCGCGG - Exonic
981782265 4:148443000-148443022 CCGCGCGCGGGGAGGACTCTGGG + Intronic
985580417 5:693026-693048 CCGCGAGCGGGGGTCACCGTCGG - Intronic
985595079 5:784416-784438 CCGCGAGCGGGGGTCACCGTCGG - Intergenic
985696952 5:1346046-1346068 CCGCGTGCAGGGGCGGTCCTGGG + Intergenic
985996468 5:3599958-3599980 GTGCGCGCCGGGGTGGCCCGCGG - Exonic
986858808 5:11903727-11903749 CCGCTGGTGGGGGTGGTCCTGGG - Intronic
989178914 5:38556782-38556804 CCGCGCGCGCGGGTGCTCCAAGG + Intronic
992269849 5:75053257-75053279 CCGCGCGCTCTGGTGGCCCCGGG + Intergenic
998139238 5:139690549-139690571 GCGCGGGCGGGGTTGGCCATGGG + Intergenic
1002058831 5:176614158-176614180 GCGCGCGCAGGGGTGGCTTTGGG - Intergenic
1003145449 6:3506359-3506381 CCGCCTGGAGGGGTGGCCCTAGG + Intergenic
1006303624 6:33206927-33206949 CCGGCGGCGGGGGTTGCCCTGGG - Intergenic
1012834782 6:104251755-104251777 CCGAGCCCTGAGGTGGCCCTGGG - Intergenic
1012997984 6:105992647-105992669 CCGCGCGCAGAGCTGGGCCTGGG + Intergenic
1014913547 6:127119719-127119741 CCGCGCGAGGCGGTTGCGCTAGG - Intronic
1016936128 6:149450693-149450715 CAGAGCGCGGGGGCGCCCCTGGG - Exonic
1017174988 6:151494205-151494227 CCGCGCGCGGGGGTGGCCCTGGG + Intronic
1018755892 6:166849560-166849582 CCACGGGCGGGGGTGGCCTGGGG - Intronic
1019298516 7:291210-291232 CCGCGCGCGGGGGGCGCCCAGGG + Intergenic
1019363101 7:616090-616112 CCGCGGGCAGGGCTGGGCCTGGG - Intronic
1023881751 7:44324992-44325014 GGGCGCGCGGGGGTGGCCCCCGG - Intronic
1027001648 7:74658197-74658219 CCGCGCGCGGTGTGGGGCCTTGG + Intronic
1028066600 7:86392031-86392053 GGGTGCACGGGGGTGGCCCTTGG + Intergenic
1029690582 7:102178670-102178692 CGGGGCCCGGGGGTGGCCCGAGG + Intronic
1034990141 7:155542886-155542908 CCTCGGGCGGGGGTGGGTCTGGG - Intergenic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1035265121 7:157685929-157685951 CGGCGCGGGGAGGTGGGCCTGGG - Intronic
1036733311 8:11284786-11284808 CCCGGCGCGGGGCTGGCCCGTGG - Exonic
1037143117 8:15540700-15540722 CCGCGAGGGTGGGAGGCCCTGGG + Intronic
1039996807 8:42541450-42541472 ACGCGCCCGGGGGCGGCACTGGG + Intronic
1040006682 8:42627031-42627053 CCGGGCATGGGTGTGGCCCTAGG - Intergenic
1040471249 8:47737597-47737619 CCGGGCGCGGGGGTCTGCCTGGG + Exonic
1044973721 8:97644146-97644168 CCGCGCGCGGGGACGACCGTGGG - Intergenic
1049608000 8:143538636-143538658 CCACGCACTGGCGTGGCCCTGGG - Exonic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1056578297 9:87872263-87872285 CTGGGGGCGGGGGTGGCCATGGG + Intergenic
1058439233 9:104991882-104991904 GCGTGCGCGGGGCTGGGCCTTGG + Intergenic
1060812777 9:126619306-126619328 CCGCGTTCGGGTGTGGCCCAGGG + Intronic
1061749880 9:132770295-132770317 GCGCGCCGAGGGGTGGCCCTTGG - Intronic
1061973968 9:134059194-134059216 CCGCGGGCGGGGGCAGCTCTGGG - Intronic
1062277098 9:135736328-135736350 CCGCGAGGGCTGGTGGCCCTGGG - Intronic
1062499775 9:136847421-136847443 CGGGGCTCGGGGGCGGCCCTGGG - Exonic
1062537735 9:137028232-137028254 CCGCGCGGGGGCGGGGCGCTCGG + Intronic
1062558850 9:137130162-137130184 CCGCGCCCGGGTGAGGCCCTGGG - Intergenic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1200310331 X:155071297-155071319 TGGCGCGCGGGGGCGGGCCTTGG - Exonic