ID: 1017179153

View in Genome Browser
Species Human (GRCh38)
Location 6:151533710-151533732
Sequence CTTCAGATGAAGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017179153 Original CRISPR CTTCAGATGAAGGAGGTGGA AGG (reversed) Intronic
900809029 1:4787218-4787240 CTACAGTGGGAGGAGGTGGATGG + Exonic
900982778 1:6056006-6056028 CTGTAGCTGATGGAGGTGGACGG + Intronic
901037262 1:6343842-6343864 CTGCAGAGCAGGGAGGTGGAAGG - Intronic
902573354 1:17361043-17361065 CTCCAGAAGAAGGGGGTGGCTGG - Intronic
902746127 1:18475807-18475829 AATCTGATGAAGGAGGTGGTTGG - Intergenic
903672974 1:25047287-25047309 ATTCATATGAATGAGGTGGAGGG + Intergenic
903727122 1:25457353-25457375 CTTCAGAAGGTGGAGGTGGGAGG - Intronic
903816187 1:26066177-26066199 GAGCAGATGAAGGAGGGGGAAGG + Intronic
904016876 1:27428515-27428537 TTTCTGTTGAAGCAGGTGGAGGG + Intronic
904413146 1:30337133-30337155 CATCAAAGGAAGGAGCTGGAAGG - Intergenic
904964947 1:34364647-34364669 CTTCACATCAAGGGGGTGGGAGG + Intergenic
906418046 1:45637960-45637982 CGTAAGATGAAGAAGGTGTAAGG + Intronic
907976396 1:59435355-59435377 CTTCAAATGGAGGGGCTGGAGGG - Intronic
908242195 1:62196833-62196855 CTTTAGGAGATGGAGGTGGAAGG - Intronic
911459296 1:98169364-98169386 ATTTAGATGAAGAAGGTGGTGGG - Intergenic
912515885 1:110216362-110216384 CTCCTCAGGAAGGAGGTGGAGGG - Intronic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915002898 1:152609740-152609762 CTACTGAGGAAGAAGGTGGAGGG - Intergenic
915873200 1:159584233-159584255 GTTCACTTGGAGGAGGTGGAGGG - Intergenic
916889447 1:169102368-169102390 CTTCAGATGAAAGAAGTGAACGG + Intergenic
918711299 1:187734385-187734407 CTACTGATGAAAGAGGTGGTGGG + Intergenic
919825133 1:201498270-201498292 CTTCTGTTGAAAGAGCTGGAAGG - Intronic
922022725 1:221720396-221720418 AGTCAGATGAAGGAGATGGATGG - Intronic
922337639 1:224630806-224630828 CTTCAGGTGAGTGAGGTGGGTGG + Intronic
922435046 1:225596505-225596527 CTTCTGATTAAGAAGGAGGAAGG + Intronic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
923006900 1:230057500-230057522 CTGCAGCTGAAGGTGGGGGACGG + Intergenic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1066268961 10:33803367-33803389 CTAGAGATGGAGGAGATGGAAGG + Intergenic
1068203857 10:53822223-53822245 ATGAAGCTGAAGGAGGTGGAGGG + Exonic
1069231834 10:66020264-66020286 CTTGAGCTGAAGAAAGTGGAAGG + Intronic
1069234438 10:66052388-66052410 CTTGAAATGAAGGATGGGGAAGG + Intronic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069854906 10:71434739-71434761 CTTGAGGGGAAGGTGGTGGAGGG + Intronic
1070330412 10:75412638-75412660 TTTCAAATGAGGAAGGTGGAGGG - Intergenic
1071599219 10:86948845-86948867 CCTCAGATGGCTGAGGTGGAAGG + Intronic
1071718617 10:88120859-88120881 CTTCAGGTGAAGGAGGAGGAAGG - Intergenic
1073369467 10:102974147-102974169 CTTCAGATGGAGGTGTGGGAGGG + Intronic
1073502644 10:103955420-103955442 CTTCTGATGCAGCAGGTGGGTGG + Intergenic
1073573336 10:104599318-104599340 ATTCAGAGGGAGCAGGTGGAGGG + Intergenic
1074106086 10:110390640-110390662 CTTCAGAAGGCGGAGATGGAAGG + Intergenic
1075052864 10:119195746-119195768 ATTCAGATGAATCTGGTGGAAGG + Intergenic
1075648178 10:124110019-124110041 CTGCAGATGGTGGAGGTGGGTGG - Intergenic
1076413159 10:130265876-130265898 CTCCAGAGGAGGGAGGTGGAGGG + Intergenic
1077262697 11:1631263-1631285 CTTCAGCGGAAGGATGAGGAAGG + Intergenic
1077472270 11:2769602-2769624 CCTCGGATGAAGGCGGTGGTGGG + Intronic
1080424979 11:32146966-32146988 CTTCAGGTGAACCAGGAGGAAGG + Intergenic
1081610394 11:44559302-44559324 CTTCAGATGTAGTAGGCGGCAGG + Intergenic
1081746255 11:45474433-45474455 CTACACATGAAGGGGATGGAGGG - Intergenic
1082066383 11:47904100-47904122 CTTCACATGGTGGAGGTGGAGGG - Intergenic
1082181002 11:49119550-49119572 CTTCAGATGAAAGTGAAGGATGG - Intergenic
1083061535 11:59877868-59877890 CTGCTGATGAAGGAGGAGGGAGG - Intergenic
1083155733 11:60821823-60821845 CTGCCAAGGAAGGAGGTGGATGG + Intergenic
1084683776 11:70681880-70681902 CTTCAGGTCAAAGATGTGGAGGG + Intronic
1085012813 11:73153009-73153031 TTCCAGTTGAAGGAGGGGGATGG - Intergenic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085129706 11:74027833-74027855 ATTCAGCTGAAGTAGGTGGTTGG - Intronic
1085251614 11:75147753-75147775 CCTCAGAAGTCGGAGGTGGAAGG - Intronic
1085477739 11:76798518-76798540 GTTCAGAGGAGGGAGGTGGAAGG - Intergenic
1085481089 11:76823607-76823629 TTTCAGGAGAAGGAGGTGGGAGG + Intergenic
1085508248 11:77072239-77072261 CAAGAGATGGAGGAGGTGGAAGG - Intronic
1086684490 11:89715328-89715350 CTTCAGATGAAAGTGAAGGATGG + Intronic
1086739644 11:90351823-90351845 GTTAAGATGAAGGACCTGGATGG + Intergenic
1087209599 11:95433309-95433331 TTTCAGAGGAAGGAAGTGAAGGG - Intergenic
1088579798 11:111303613-111303635 CTTGAGCTGAAGGACTTGGAAGG - Intronic
1089046286 11:115504155-115504177 CTTCGGATGTAGGAAGTGGGGGG + Intronic
1089365629 11:117919249-117919271 ATGCGGATGTAGGAGGTGGAAGG - Intronic
1090234910 11:125140042-125140064 CTCCACATGAAGGAGGGGGTGGG - Intergenic
1090237856 11:125162975-125162997 CTTCAGATAAGGGAGGGGGAGGG - Intergenic
1091600156 12:1913093-1913115 CTGAAGATCGAGGAGGTGGATGG - Exonic
1091681858 12:2533102-2533124 CTTGAGAGGAAGGATCTGGAGGG + Intronic
1092043775 12:5409884-5409906 CTTCAGCTGAAGGATTAGGAGGG - Intergenic
1092944707 12:13441905-13441927 CACCAGATGAGGAAGGTGGAAGG - Intergenic
1093189101 12:16054814-16054836 TGTCAGATGGTGGAGGTGGAGGG + Intergenic
1093684318 12:22039105-22039127 CTCCATATAAAAGAGGTGGAGGG - Intergenic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1094474878 12:30833334-30833356 CTTCAGCTGGAGGTGGAGGATGG - Intergenic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1098203050 12:68077476-68077498 CTTAAGCTGAAGAAGATGGAAGG + Intergenic
1098546272 12:71715001-71715023 CTTCAGAAGACTGAGATGGAAGG + Intergenic
1098848132 12:75562993-75563015 ATTCAGATGAAAGAAGTTGAAGG + Intergenic
1099424859 12:82511032-82511054 CTAAAGATGAAGGAGGAAGATGG - Intergenic
1102582677 12:113900678-113900700 CTCCTGATGAAGGAGGAGGAAGG + Intronic
1103242881 12:119429607-119429629 TTTCAGAAGATGGAGGTGAAGGG - Intronic
1103558983 12:121782463-121782485 GTTCAGTGGAAGGAAGTGGAGGG - Intronic
1103721154 12:122976279-122976301 CTCCAGGGGAAGGAGGAGGAGGG - Exonic
1103966094 12:124640664-124640686 CATGAGACGTAGGAGGTGGATGG - Intergenic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1106741939 13:32653602-32653624 CTTAGGATGAGGGAGGTAGAGGG + Intronic
1107063508 13:36187464-36187486 CTTCAGATGAATGAGATCTATGG + Intronic
1107651213 13:42547124-42547146 CTGCATGTCAAGGAGGTGGATGG - Intergenic
1108242220 13:48476822-48476844 GATCAGATGAAGCAGATGGAAGG + Exonic
1109140188 13:58704853-58704875 TTTCAGGTGCAGGATGTGGAAGG + Intergenic
1109956036 13:69567579-69567601 CTACACATGGAGGAGGTGGTTGG - Intergenic
1110127196 13:71960124-71960146 CTTCAGATGAAAGTGATGGTTGG + Intergenic
1112675803 13:101700230-101700252 CTTCAGGAGAAAGAGGTTGAGGG - Intronic
1112834493 13:103497633-103497655 CTTTATAAGAGGGAGGTGGAAGG - Intergenic
1113056958 13:106278498-106278520 CATCGGATGAAGGTGGTGAAGGG - Intergenic
1114260407 14:21032509-21032531 CAACAGATGAGGAAGGTGGAGGG - Intronic
1114582434 14:23774622-23774644 GTTGAGATGAGGGAGATGGAAGG + Intergenic
1117736140 14:58770713-58770735 GGTGAGATGAAGGAGGTGGTGGG - Intergenic
1120597067 14:86453513-86453535 CAGCAAATGAAGGCGGTGGATGG + Intergenic
1121413681 14:93764284-93764306 CTTCAGCTGAAGGCGGGGGTGGG - Intronic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1122031853 14:98918113-98918135 CTTCATATGACGGATTTGGAGGG - Intergenic
1122187886 14:100015694-100015716 TTCCAGCTGAAGAAGGTGGAGGG - Intronic
1122192191 14:100054496-100054518 CATCAGATAAAGGAAGTGGCTGG - Intronic
1123954981 15:25325843-25325865 CTTGAGATGATGCAGGTGCATGG - Intergenic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1126495883 15:49290183-49290205 TTTCAGATGAAGGAAATGGGTGG - Intronic
1127395131 15:58538280-58538302 CTTCAGATGAAGCAGATGCCAGG + Intronic
1127668276 15:61170224-61170246 CTTCAAATCAAGGAGTTGGCAGG + Intronic
1127887472 15:63214954-63214976 CTCCATAAGAATGAGGTGGAAGG - Intronic
1128452334 15:67812860-67812882 CTTTAGAAGAAGGACCTGGAGGG - Intergenic
1129151855 15:73694145-73694167 CTGGAGATGAAGCACGTGGAGGG - Intronic
1129827646 15:78645104-78645126 AGTCTGATGAAGGAGGTGGCTGG - Intronic
1130903681 15:88225502-88225524 CTGCAGATGAATGAAGTGGGAGG + Intronic
1132248022 15:100312225-100312247 CTTTAGATGAGGGAGGCAGAGGG + Intronic
1132364381 15:101246204-101246226 TGTCAGAAGAAAGAGGTGGATGG - Intronic
1132643721 16:989384-989406 CCCCAGATGAAGGAGATGGGTGG + Intergenic
1133345073 16:5064481-5064503 CTTCAGCTGCAGCTGGTGGATGG - Intronic
1134256494 16:12616347-12616369 CTTGAGTTGAGGGAGGTTGAGGG - Intergenic
1134518163 16:14903723-14903745 CTTCAGAGGATGGGGGAGGAGGG + Intronic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1136281276 16:29212953-29212975 CTCCAGGTGAAGGTGGTGGGCGG - Intergenic
1137018500 16:35399059-35399081 CATCTGATGAAGGAGGATGAAGG - Intergenic
1137338064 16:47571293-47571315 CTGCAGCTGAAGCAGGTGGTGGG + Intronic
1137961081 16:52882946-52882968 CATCAGAAGAAGGAGGAGAATGG - Intergenic
1138829462 16:60359291-60359313 CATCAAATGAAGGAAGTTGAAGG + Exonic
1139960132 16:70712706-70712728 CTTCTGAGGGAGGAGGTGGCAGG + Intronic
1140988635 16:80186032-80186054 ATTCAGAATAAAGAGGTGGATGG + Intergenic
1142085645 16:88178881-88178903 CTCCAGGTGAAGGTGGTGGGCGG - Intergenic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143934552 17:10469297-10469319 TATCAGATGAAGAAGGTGGCAGG + Exonic
1143940539 17:10536590-10536612 CTTCAGAGGGAGCTGGTGGAGGG - Exonic
1144220613 17:13096672-13096694 CTGCAGATAAAGGGGCTGGATGG + Intergenic
1144721135 17:17470633-17470655 CTGCAGATGAGGGAGATGGTTGG + Intergenic
1146912149 17:36655683-36655705 CTTGGCATGAAGGTGGTGGAGGG + Intergenic
1146919581 17:36701561-36701583 ATGCAGTTGAAGGAGGAGGAAGG - Intergenic
1147304166 17:39551869-39551891 TTTCTGAGGAAGGAGGAGGATGG - Intronic
1147905144 17:43817898-43817920 CTCCAGAGGAAGGAGGGGGTGGG - Intronic
1147937557 17:44021697-44021719 GTTCTGATGAAGGAAGTGGTGGG - Intronic
1148262191 17:46193395-46193417 CTTCAGATTAAAGGGGGGGAGGG - Intronic
1149414155 17:56441243-56441265 CTTCAGATGAGGGAAGTAGAGGG + Intronic
1149420851 17:56509955-56509977 CTTCAGAATATGGAGGTGGACGG + Intronic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1150265267 17:63828132-63828154 CTTCAGATGGAGCTGGAGGAGGG + Exonic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1151027169 17:70691299-70691321 GTTCAGATAAAGGAGGAGAAAGG - Intergenic
1151090772 17:71437986-71438008 CCTCAGAAGAAGGTGGTGGTAGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1152079558 17:78178267-78178289 CTTCAGATGCTGGTGGTGGGTGG - Intronic
1152680253 17:81664199-81664221 CTGCGGCTGAAGGAGCTGGAAGG + Intergenic
1152984042 18:306078-306100 CTGCAGATGAAGGATGAGAAGGG + Intergenic
1153362267 18:4210617-4210639 CTGCAGATGAAAGAGGACGATGG + Intronic
1153617403 18:6947524-6947546 CCACAGATGAAGGAGGTGCCTGG - Intronic
1153934196 18:9906115-9906137 CTACAGGAGAAGGAGTTGGAGGG + Intergenic
1155224614 18:23718563-23718585 CTTCAGAGGATGGAGGTGTGAGG + Intronic
1155740447 18:29282353-29282375 GTTCAGAAGAAGCATGTGGATGG - Intergenic
1156000793 18:32381888-32381910 CTTCAGGTGAACGAGGTTAAGGG - Intronic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1162180562 19:8865973-8865995 CTTGAGAGGAAGGAGGAAGAGGG + Intronic
1162199245 19:9009050-9009072 CCCCGGATGGAGGAGGTGGATGG + Intergenic
1162718092 19:12646624-12646646 GTTCAATGGAAGGAGGTGGATGG - Exonic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163279268 19:16305468-16305490 CATCAGAGGAAGCTGGTGGAAGG + Intergenic
1163324056 19:16591991-16592013 CTTCTGATGCAGGAGGTCTAGGG - Intronic
1163783078 19:19260760-19260782 CTTCTGAGGAAGGAGGGGGGCGG - Intronic
1164769891 19:30800399-30800421 TCTCGGCTGAAGGAGGTGGAAGG - Intergenic
1165015708 19:32878529-32878551 CTGCAGATCTAGGAGCTGGAAGG + Intergenic
1166645566 19:44529419-44529441 CTTCAGATGCGGGAGGAGGGAGG - Intronic
925354665 2:3230387-3230409 CTGCAGCTGAAGGGGGTGGGAGG + Intronic
925611793 2:5707239-5707261 CTTCGGATGAAGGAGCCGGGAGG + Intergenic
925785367 2:7427234-7427256 CATCAGATGAGGAAGGTGCATGG + Intergenic
926384196 2:12319841-12319863 CTGGAGATGAAGTAGGTGGAGGG + Intergenic
926572430 2:14544286-14544308 CCTGAGATGAAGGTGTTGGAGGG - Intergenic
928046968 2:27944387-27944409 GTTAAGAGGAAGGTGGTGGAGGG - Intronic
929049365 2:37822708-37822730 CATGGGATGAAGGAGCTGGAGGG - Intergenic
929375258 2:41278966-41278988 CTTCAGTTGAATGAGTTGAATGG + Intergenic
930376473 2:50573413-50573435 TCTCAGATGAAGGACCTGGATGG + Intronic
932208244 2:69903175-69903197 CTTCAGGGTAAGAAGGTGGATGG + Exonic
932820577 2:74896252-74896274 CTTCAGAGGGTGGAGGGGGAAGG + Intergenic
933415998 2:81986478-81986500 AATCAGATGACGGACGTGGAGGG - Intergenic
933616734 2:84489639-84489661 CTTAAGAATAAGGAGGTGCAAGG - Intergenic
933832077 2:86219114-86219136 TTTCAGTTGTAGGATGTGGATGG - Intronic
934557787 2:95296577-95296599 GGACAGATGAAAGAGGTGGAAGG + Intergenic
936513822 2:113169134-113169156 CTTCAGACGGAGGAAGTGGTTGG - Intronic
938074893 2:128326535-128326557 CTGCAGAAGAGGGAGGTGGCAGG + Intergenic
938119992 2:128626469-128626491 CTTCACATGAAGGACATGAAGGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940640465 2:156340955-156340977 CTCCAGAGGTAGGAGGGGGAAGG + Intronic
941317350 2:164009729-164009751 CTTCAGATCAGGGAGATTGAAGG - Intergenic
942388695 2:175468910-175468932 CTACAGATGAGGGCTGTGGATGG - Intergenic
944504492 2:200396407-200396429 CTGCAGATGATGGAGATAGAAGG + Intronic
945392091 2:209276663-209276685 ATTCAGAAGACTGAGGTGGAAGG + Intergenic
945864583 2:215161962-215161984 GTTCTGGTGAAGGTGGTGGAGGG - Intergenic
945943813 2:215975100-215975122 CTGCAGTAGAAGTAGGTGGAGGG - Intronic
946185828 2:217979871-217979893 ATCCAGGAGAAGGAGGTGGATGG - Intronic
946809355 2:223506852-223506874 CTACAGATGTAGGAGGTGAGAGG + Intergenic
947329616 2:229014943-229014965 CTTTACATGAAGGTGGTGGTGGG + Intronic
947550127 2:231039427-231039449 CTTAAGAGGAAGGGGCTGGAGGG - Intronic
947704321 2:232262152-232262174 CTTAACATGAAGGAGGTGTTAGG + Intronic
1170915387 20:20619227-20619249 CTCCAGCTGTAGGCGGTGGAGGG + Intronic
1173093554 20:40001249-40001271 ATTCTGATGAAGTAGGTGTAGGG - Intergenic
1173925779 20:46780167-46780189 ATACAGATGGAGGAGGTGGAGGG - Intergenic
1174103177 20:48142777-48142799 CATCTGTCGAAGGAGGTGGAAGG + Intergenic
1174548767 20:51345854-51345876 GTTCAGATAAAGGCCGTGGAGGG + Intergenic
1175661371 20:60815910-60815932 CCTCAAATGAAGGTGGTGGTGGG - Intergenic
1175821165 20:61909682-61909704 CTTCAGAAGAGGGAGGCAGAGGG - Intronic
1177995306 21:28089687-28089709 CTTCTGGTGGAGGTGGTGGAGGG + Intergenic
1179068848 21:38053048-38053070 TTTCAGAGGAAGGAAGGGGATGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
949332525 3:2937960-2937982 ATTTAGATGGAAGAGGTGGAAGG + Intronic
950267707 3:11587280-11587302 CTGCCGATGAAGGAGCTGCATGG + Intronic
950490202 3:13299955-13299977 CTTAAGATGAAGGTGCTGGCAGG + Intergenic
950539852 3:13605321-13605343 ATGCAGATGGAGGTGGTGGATGG - Intronic
953535783 3:43775702-43775724 CTTCAGAGGATGGAGATGGAGGG - Intergenic
953915360 3:46916432-46916454 GTTCAGAGGTAGGAGGTGGTTGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954808309 3:53232789-53232811 CTTCAGCTGGAGCAGGTGGCCGG + Intronic
955706830 3:61736505-61736527 ATTCAGATGAAGAAGGGTGAAGG + Intronic
956023387 3:64956249-64956271 TTTCAGAGGAGGGAGGTCGAGGG + Intergenic
957034451 3:75281090-75281112 CCTCTGCTGAAGGAGGTGGGGGG - Intergenic
957682651 3:83457508-83457530 CTTCTGTTGAAGGAGAGGGAAGG - Intergenic
957934927 3:86929796-86929818 AGTCAGATCAAGGAGGTTGAGGG + Intergenic
958021189 3:87998189-87998211 CTTAACATCAAGGAGGTAGAGGG - Intergenic
959619234 3:108382097-108382119 ATTCAGCTGCAGGAGGTTGAAGG - Intronic
959686891 3:109157351-109157373 CTTCATGAGATGGAGGTGGAGGG - Intergenic
960107103 3:113809628-113809650 CTTCAGATAAAGGAAGAGGGAGG - Exonic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963327355 3:143877153-143877175 CTCAAGATGGAGGAGGAGGAGGG - Intergenic
963366185 3:144337473-144337495 CATGAGAGGAAGGAGGGGGAAGG - Intergenic
965567776 3:170138871-170138893 CTCCAAATGAAGGAAGTGGAAGG - Intronic
965673811 3:171174026-171174048 CTGCAGAGGAAGGAGGAGCAGGG + Intronic
966286346 3:178300468-178300490 CTTCATATTGGGGAGGTGGAAGG - Intergenic
968216030 3:196891688-196891710 CCTCAGATGGATGAGGTGGGAGG + Intronic
968442890 4:633490-633512 CTGCAGGGGAAGGGGGTGGAGGG + Intronic
968543135 4:1178400-1178422 CTGAAGATGAGGGAGGGGGAGGG - Intronic
970485424 4:16520190-16520212 CATCAGATGATGGGGGTGGGGGG + Intronic
970926019 4:21453313-21453335 CTTTATATGAAAGAGGTAGAAGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
975091620 4:70410640-70410662 CTGCTGATGAAATAGGTGGAAGG + Intergenic
975783905 4:77867627-77867649 CTTCAGAAGACTGAGGTGGGAGG - Intronic
975840122 4:78464958-78464980 GTCCGGATGAAGGAGGTGAAAGG - Intronic
976230938 4:82842257-82842279 CTCCAGAGGAAGGGGGAGGAGGG + Exonic
977545924 4:98376835-98376857 ATTCAGAGGAGGGGGGTGGAAGG + Intronic
978401872 4:108339897-108339919 GTACAGATGAAGGAGGTTAAAGG - Intergenic
980465006 4:133163216-133163238 CTGGAGAGGAAGGAGCTGGATGG + Exonic
981069773 4:140522999-140523021 CTTCAATTCAAGGAGTTGGAAGG + Intergenic
985865627 5:2511887-2511909 CTGCAGATCATGGAGGTGGGAGG + Intergenic
986190703 5:5494165-5494187 ATTCAGTTCAAGGTGGTGGAAGG - Intergenic
986465206 5:8014133-8014155 CTTCAGATGATGGAGCCAGATGG - Intergenic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
993473600 5:88336202-88336224 CTTTGGAAGAATGAGGTGGAAGG - Intergenic
993852669 5:93030808-93030830 AAACAGATGAAGGAGATGGAAGG - Intergenic
997445049 5:133934445-133934467 GTCCAGCTGAAGGAAGTGGAAGG - Intergenic
997882239 5:137601473-137601495 CATCAGCTGAAGGGAGTGGAGGG + Intergenic
998849588 5:146340312-146340334 TCTCAGATGAAGGACGTGGCTGG - Exonic
1000340192 5:160271035-160271057 ATTAAGATTTAGGAGGTGGAGGG + Intronic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000844175 5:166258314-166258336 CTGCAGTTAAAGGAGGAGGAAGG + Intergenic
1002065714 5:176650734-176650756 CTGCAGATAAAGCAGGTGGGTGG + Intronic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1003168432 6:3701322-3701344 CTTGAGATCATGTAGGTGGAAGG - Intergenic
1003949059 6:11101495-11101517 CTTCCGAAGGAGGAGATGGAAGG + Intronic
1003955012 6:11154926-11154948 TTCCAGAAGAAGGTGGTGGATGG - Intergenic
1004265512 6:14145424-14145446 CTGAAGCTGAAGGAGGTGGCTGG - Intergenic
1005901092 6:30216794-30216816 CCTCAGATGAAGGAGGGAGAAGG - Intergenic
1005912931 6:30326785-30326807 CTGCGGAAGAAGGAGGAGGAGGG - Intronic
1008030509 6:46688609-46688631 CTTCAGGGCAAGGAGGTGCACGG + Exonic
1008519742 6:52351823-52351845 CTTCAAATCAAGTAGGTGGGGGG - Intergenic
1010327870 6:74586651-74586673 CTTAAGATGAAGGTGTTGGCAGG - Intergenic
1010792041 6:80075751-80075773 CTACAGCTCAAGGAGGAGGAAGG + Intergenic
1012000501 6:93648324-93648346 GTTGAGAAGAAAGAGGTGGAAGG - Intergenic
1012334614 6:98039773-98039795 CTTCAGATGACGAACGTAGATGG - Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1013003275 6:106046297-106046319 TTTCAGAAGAAGGAGGTGGTTGG + Intergenic
1013226666 6:108123976-108123998 CTTCAGATGAAGGCGCTACAAGG - Intronic
1013286339 6:108685438-108685460 CTTCAGATCAAGGAGGTGAAAGG + Intergenic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1014252745 6:119131215-119131237 CTTCAGATGGAGGAAGTAAAGGG - Intronic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1017179153 6:151533710-151533732 CTTCAGATGAAGGAGGTGGAAGG - Intronic
1017809063 6:157971018-157971040 GCTGAGATGAAGGAGGTAGAGGG + Intergenic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1019372663 7:671087-671109 CTGAGGAAGAAGGAGGTGGACGG - Intronic
1023055578 7:36287299-36287321 CTATATAAGAAGGAGGTGGAAGG - Intronic
1023372209 7:39522809-39522831 CCTCAGTTGAAGGTGCTGGAGGG - Intergenic
1023576584 7:41634677-41634699 CATCAAATAAAGGAGGTGAAAGG + Intergenic
1023925930 7:44669637-44669659 CATCATATGAAGGGGGTGGAGGG + Intronic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025003665 7:55339144-55339166 CTTCTGGTGATGCAGGTGGAGGG - Intergenic
1026136088 7:67662324-67662346 CTGAGGATGAGGGAGGTGGAGGG - Intergenic
1026935172 7:74250599-74250621 CTGGAGACGAAGGAGGAGGATGG - Intronic
1026980346 7:74523018-74523040 CCTCAGATGTAGGAGGTACAAGG + Intronic
1028107640 7:86899054-86899076 CTGAAGATGATGGATGTGGATGG + Intronic
1028629066 7:92913812-92913834 CTTCTTATAAAGGAGGTTGAAGG + Intergenic
1029124065 7:98285350-98285372 TTCCAGACGATGGAGGTGGAGGG + Intronic
1029874877 7:103739809-103739831 CTGCATATGAAGGAGGCAGAAGG + Intronic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1032184383 7:129711409-129711431 CTTCTGAGTAAAGAGGTGGAAGG + Intronic
1033495422 7:141889120-141889142 CTTCAGATGAGGGAGGGAAATGG + Intergenic
1033514629 7:142093851-142093873 CTTCAGTTACAGGAGGTGAAGGG + Intronic
1034975612 7:155447888-155447910 CCTCAGGTGAGGGAGGTGGCTGG + Intergenic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035650710 8:1261673-1261695 CTCCAGATCAGGGAGGAGGAAGG + Intergenic
1035710386 8:1708985-1709007 CAACTGATCAAGGAGGTGGAAGG - Intergenic
1036079048 8:5533445-5533467 CCTCAGTTGTAAGAGGTGGATGG + Intergenic
1036121054 8:6018221-6018243 ATTCAGATGAAGAAAGTGGCAGG + Intergenic
1037135231 8:15452067-15452089 AGTCACATGAAGGAGTTGGAGGG - Intronic
1038229367 8:25686049-25686071 CCTCAGAGGAGGGAGGTGCATGG + Intergenic
1040709487 8:50171057-50171079 CATCAGATGACAAAGGTGGAAGG - Intronic
1042015133 8:64300737-64300759 CTTAAGAATAAGGGGGTGGATGG - Intergenic
1042381498 8:68119625-68119647 ATTGAGGTAAAGGAGGTGGAAGG - Intronic
1043034915 8:75184479-75184501 CCTCAAATAAAGGAGGTGAAAGG + Intergenic
1043477410 8:80619001-80619023 AATCAGAGGAAGGGGGTGGAGGG - Intergenic
1044609937 8:94081200-94081222 CATTAGATGTAGGGGGTGGAGGG - Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1046635636 8:116672519-116672541 ATTCAGGAGAACGAGGTGGAAGG + Intronic
1047911432 8:129534434-129534456 GATCAGTTGAAGGAGATGGAAGG - Intergenic
1048985264 8:139731572-139731594 CTTGAGAGGTAGGAGGTGGGAGG + Intronic
1050910432 9:11062143-11062165 CTTCAAGTAAAGGAGGTGAATGG + Intergenic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1055171619 9:73266031-73266053 CTTCAGAGGATGCAGGTGGTAGG + Intergenic
1056249999 9:84737991-84738013 CCTCAGCTGAAAGAGGTTGAAGG - Intronic
1056531629 9:87493156-87493178 CATGAGATGAAGGAGAAGGAAGG - Intergenic
1057912929 9:99034194-99034216 CTTCCCATGACGGAGGTAGAGGG - Intronic
1057955109 9:99401149-99401171 CTTCAGAGGAACTATGTGGAAGG - Intergenic
1058460442 9:105177518-105177540 CTTCTGAAGAAGGAAGTAGAGGG + Intergenic
1059431057 9:114250539-114250561 CTTCAGGGGAAGGAGCGGGAGGG + Intronic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1061130139 9:128703801-128703823 CTCCAGAGGAAGGGGGTGGGAGG - Intronic
1061744180 9:132727726-132727748 AGTCAGATGAAGGAGGCGGTTGG - Intronic
1062076199 9:134591276-134591298 AGTCAGATGAAGGAGGCGGTTGG - Intergenic
1188137224 X:26504941-26504963 CTTCAGGTAGAGGGGGTGGAAGG - Intergenic
1188137266 X:26505082-26505104 CTTCAGGTAGAGGGGGTGGAGGG - Intergenic
1190296428 X:49030294-49030316 ATTCTGATGGAGGAGGAGGAGGG - Exonic
1192433393 X:71127462-71127484 CTTCAGGTAAGAGAGGTGGAAGG + Exonic
1193158267 X:78198026-78198048 CTTCAGGGGAGGCAGGTGGATGG + Intergenic
1193255244 X:79341038-79341060 CTTCATATGATTGATGTGGAGGG + Intergenic
1193261526 X:79412188-79412210 ATTCACATGAAGGATGTGGTAGG - Intergenic
1194048159 X:89034815-89034837 GTTCAGAAGAAGGAAGTGGTGGG + Intergenic
1195287358 X:103398035-103398057 CTTCACATCAAGGAAGAGGACGG - Intergenic
1195478090 X:105310018-105310040 TTTCAGATAAAAGAGTTGGAGGG - Intronic
1197329422 X:125135057-125135079 ATTCAGATAAAGGAGATTGAAGG - Intergenic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1199102614 X:143821727-143821749 CTTCAGGTGATTGAAGTGGAAGG - Intergenic
1199297043 X:146171140-146171162 TTGCAGATGAAGGAGAGGGATGG - Intergenic
1199721258 X:150544160-150544182 CTTCAGATGAATGCCATGGATGG + Intergenic
1200362665 X:155626905-155626927 CTTCAGATGAAGGAGCTTTGGGG - Intronic
1201616828 Y:15909685-15909707 CCTCAGAGGAAGCAGGTGAATGG + Intergenic