ID: 1017179484

View in Genome Browser
Species Human (GRCh38)
Location 6:151536990-151537012
Sequence AGGCGCCCCCAGATCTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017179484_1017179487 3 Left 1017179484 6:151536990-151537012 CCTTGAGAGATCTGGGGGCGCCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1017179487 6:151537016-151537038 GATGTTAAGTAAAGCTCCATGGG 0: 1
1: 0
2: 0
3: 5
4: 108
1017179484_1017179486 2 Left 1017179484 6:151536990-151537012 CCTTGAGAGATCTGGGGGCGCCT 0: 1
1: 0
2: 0
3: 11
4: 105
Right 1017179486 6:151537015-151537037 AGATGTTAAGTAAAGCTCCATGG 0: 1
1: 0
2: 0
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017179484 Original CRISPR AGGCGCCCCCAGATCTCTCA AGG (reversed) Intronic
900105706 1:980151-980173 AAGCCCTCCCAGATGTCTCAAGG - Exonic
901743123 1:11355470-11355492 AGGCGCCGGCAGATTTCTCGAGG + Intergenic
901849828 1:12008373-12008395 AGGCGCCCCCACCTCCCTCCCGG + Intronic
903779761 1:25813835-25813857 AGGCGCCCCCACATCTTGCTGGG - Intronic
904306079 1:29591176-29591198 AGGAGCTCCCAGATCACTCCTGG - Intergenic
906726478 1:48048245-48048267 AGCCGCCCCCAGATCCCTGAGGG - Intergenic
908336273 1:63127324-63127346 GGTCTCCCCCAGATCTCTGAGGG - Intergenic
908438542 1:64130840-64130862 AGGGGCAAACAGATCTCTCAAGG - Intronic
909027100 1:70494658-70494680 AGGAGCTCCCAGCTCTCTGAAGG - Intergenic
912692261 1:111813182-111813204 AGGGGCCCCCAGATCACTCTTGG + Intronic
915534255 1:156525319-156525341 AGGATTCCCCAGTTCTCTCAGGG + Intergenic
919985495 1:202671234-202671256 AGGCAGCCCCTGATCTGTCAAGG + Intronic
920879647 1:209867826-209867848 AGGAGCCCACAGATGTCTCCTGG - Intergenic
923614700 1:235527108-235527130 AGGAGACCCCAGAGCTCCCAGGG - Intergenic
1063100459 10:2945553-2945575 AGGGGACCCCAGACCTCTGAAGG - Intergenic
1063462178 10:6221834-6221856 AGGAGCCCCCAGAACCCACACGG - Intronic
1067842000 10:49688547-49688569 AGGGGCCCCCAGCTCACTCAGGG + Intronic
1069054904 10:63834680-63834702 AGATGCCCCAAGATTTCTCATGG + Intergenic
1070831878 10:79422739-79422761 AGGCCCTCCCAGACCTCTCGCGG + Intronic
1071710606 10:88045440-88045462 AAGTGCCCCTGGATCTCTCAGGG - Intergenic
1075650926 10:124128095-124128117 AGGGTCCCTCAGGTCTCTCAGGG - Intergenic
1077534700 11:3118080-3118102 AGGTTCCACCTGATCTCTCATGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1085304767 11:75479081-75479103 AGGCTCCCACAGATATCTCCAGG - Intronic
1088980631 11:114859911-114859933 AGGCCCACCCAGATCACCCAAGG - Intergenic
1089299935 11:117492549-117492571 AGGGGCCCCCTCACCTCTCAGGG - Intronic
1089598825 11:119600488-119600510 ATGGTGCCCCAGATCTCTCAGGG - Intergenic
1089691059 11:120186904-120186926 AGGAGTCCCCAGGTCTCCCAGGG + Intergenic
1092871347 12:12808570-12808592 AGGCACCCCCAGACATCTTATGG + Intronic
1102041624 12:109804724-109804746 AGGCGACACCAAACCTCTCATGG + Intronic
1116864696 14:50022206-50022228 AGCTGGCCCCAGATCTATCAAGG - Intergenic
1127714859 15:61640177-61640199 TGGAGCACCCACATCTCTCATGG - Intergenic
1129412871 15:75359527-75359549 AGGGGCACCCAGATCCCTCGGGG + Intronic
1129663705 15:77567470-77567492 ACCTGCCCCCAGGTCTCTCAAGG - Intergenic
1132957038 16:2599767-2599789 TGGCTCTCTCAGATCTCTCAGGG + Exonic
1135204656 16:20473112-20473134 CTGTGCCCCCAGATCTCTAATGG + Intronic
1135214233 16:20550700-20550722 CTGTGCCCCCAGATCTCTAATGG - Intronic
1136783704 16:32922592-32922614 CGGCCCCCCCACTTCTCTCAAGG - Intergenic
1136886084 16:33931214-33931236 CGGCCCCCCCACTTCTCTCAAGG + Intergenic
1144786922 17:17837080-17837102 AGGGGTCCCCCGCTCTCTCAAGG - Intergenic
1144802924 17:17943576-17943598 AGCTGCCTCCAGATCTCTCTTGG + Intronic
1146588210 17:34101326-34101348 AGGGGCTTCCAGATCTCTAAAGG - Intronic
1147143975 17:38474745-38474767 CGGCCCCCCCACTTCTCTCAAGG - Intronic
1147996337 17:44362306-44362328 AGTCTCCCCCAGCTCTCTCGGGG - Intronic
1148475001 17:47922867-47922889 AGGCGCCCCCAGTTCTCACTTGG + Intronic
1149493866 17:57104798-57104820 AGGCGCTCCCTGATCTTCCAAGG - Intronic
1151468762 17:74304823-74304845 TGGCCCACCCAGATCACTCATGG - Intronic
1152581047 17:81165773-81165795 TGGCGGCCCCAGATCTCGGAGGG - Intronic
1156495555 18:37523286-37523308 ATGCTCCCCCAGGTCTCTCTTGG + Intronic
1160426039 18:78779991-78780013 ATGCACCCCCAGATGGCTCATGG + Intergenic
1161535857 19:4818096-4818118 AGGAGCCCCCAGATGTGTCCTGG - Exonic
1165733846 19:38163619-38163641 AGGCCCACGAAGATCTCTCAGGG + Intronic
1165783668 19:38448302-38448324 AGGACCCCCCAGTTCTCCCATGG - Intronic
1165789928 19:38485252-38485274 AGGGGCCCCCAGATCCCTTAGGG + Intronic
1166828025 19:45621425-45621447 AGGCCCCCCCCGATCTCACCAGG - Intronic
925351574 2:3204580-3204602 AGGCGCCCACAAAACTTTCAAGG + Intronic
934856806 2:97734864-97734886 AGGTGTCCCGAGCTCTCTCAGGG - Intronic
945530848 2:210950959-210950981 AGGCGCCCCCACCTCCCTCCCGG - Intergenic
948656735 2:239480774-239480796 AGGCACCCCCAGTTCTCTGGAGG - Intergenic
1171189728 20:23150602-23150624 AGGTGCCCCCAGAGATCTCAGGG + Intergenic
1172515268 20:35528746-35528768 GGGCGCCCACAGATCCCGCAGGG - Exonic
1176028425 20:62998190-62998212 AGGGCCCCAGAGATCTCTCAGGG + Intergenic
1176093530 20:63329373-63329395 ATGCCCCCCCAGAACTGTCATGG + Intronic
1179502716 21:41820142-41820164 ATCCGCCCGCAGATCTCGCAGGG + Exonic
1179787097 21:43736077-43736099 AAGCGCCTCCAGCTCTGTCAAGG - Intronic
1180707342 22:17817758-17817780 AGGCGCCCCCAGGCCCCGCAAGG - Exonic
1180988548 22:19919865-19919887 AGGAGCCCTCAGACCTCTCAGGG + Intronic
1182049107 22:27299624-27299646 AGGCACCCACAGAGCTCACAGGG + Intergenic
1184186512 22:42868724-42868746 AGGCCCTGCCAGATCTCTCACGG + Intronic
1184687237 22:46102205-46102227 TGGGGCCACCAGATCCCTCAGGG + Intronic
1184810796 22:46830386-46830408 AGCAGCCCTCAGATCTCCCAGGG + Intronic
950539037 3:13599136-13599158 AGGCTCCCCAAGATGACTCAGGG + Intronic
963247122 3:143073747-143073769 AGGCGCCCCCACCTCCCTCCCGG - Intergenic
964296605 3:155240391-155240413 AGGAGACCCCACATCCCTCATGG - Intergenic
968067944 3:195769185-195769207 AGGAGACCCCGGATCTCTCACGG - Intronic
970247643 4:14080141-14080163 AGAAACCCCCAGATGTCTCAAGG - Intergenic
981552067 4:145952054-145952076 AGCATCCCCCAGACCTCTCAAGG - Intergenic
983784199 4:171711834-171711856 AGGGGGCCCCAGAGCTCCCATGG + Intergenic
983803163 4:171961339-171961361 AGGAGCCACAAGTTCTCTCAGGG + Intronic
984427523 4:179606964-179606986 AAGGGCCCCCAGAGCTCTGAGGG + Intergenic
985771595 5:1815228-1815250 AGGCTGCCACAGATCACTCAGGG + Intronic
996218035 5:120892445-120892467 AGGAGCTCCCAAATTTCTCAAGG + Intergenic
999306369 5:150522070-150522092 AGGTGCCCCAAAATCTGTCAAGG + Intronic
999987078 5:157014452-157014474 AGGCGCCCCCACCTCCCTCCCGG - Intergenic
1001889410 5:175326769-175326791 AGGGGCCCCCAGAACCCTCATGG + Intergenic
1003817189 6:9854704-9854726 ATGGGCCCCCAGATCTCTTCTGG - Intronic
1004522765 6:16377879-16377901 AGGCTCCACCAGGTCTTTCAGGG + Intronic
1006034338 6:31199867-31199889 ACGCCCACCCAGATCTCTCCTGG - Intronic
1013530725 6:111017306-111017328 AGGCGCCCCCACCTCCCTCCCGG + Intronic
1013582827 6:111552757-111552779 TGCAGCCCCCAGATCTCCCAGGG - Intergenic
1017179484 6:151536990-151537012 AGGCGCCCCCAGATCTCTCAAGG - Intronic
1018801492 6:167226079-167226101 AGGCGCCCCCTGATCTCAGGTGG - Intergenic
1023294851 7:38703931-38703953 AGGCAGCCCCAGATCTCTGGGGG + Intergenic
1024801686 7:53087148-53087170 AGGAGCCCCCAGGTCTTTCCTGG - Intergenic
1026870285 7:73846894-73846916 AGGGGCCCACTGATCTCACAAGG + Intergenic
1029444086 7:100603282-100603304 AAGCTGCCCCAGGTCTCTCAAGG + Intronic
1030288361 7:107848416-107848438 AGGCGCCCCCACCTCCCTCCAGG - Intergenic
1034362800 7:150515356-150515378 AGGGGTACCCAGATCACTCATGG + Intronic
1035553458 8:545924-545946 AGGCGCCCACAGATTCCTGAGGG + Intergenic
1040309360 8:46228783-46228805 AGAAGCCCCCAGGTCTGTCACGG + Intergenic
1040309543 8:46229646-46229668 AGAAGCCCCCAGGTCTCTCCCGG + Intergenic
1040310825 8:46235986-46236008 AGGAGCCCCCAGGTCTGTCCAGG + Intergenic
1041826236 8:62099251-62099273 AGGGGACCCCACATCTATCATGG + Intergenic
1045233552 8:100329055-100329077 AGGTGCCTCCAGATCTGTCCTGG + Intronic
1046715059 8:117558264-117558286 AGGAGCCCCCAGAATCCTCAGGG - Intergenic
1052251372 9:26401699-26401721 AGATTCCACCAGATCTCTCAGGG - Intergenic
1052970317 9:34373329-34373351 AGGCCTCCCCAGATCACACATGG + Intronic
1053537275 9:38938117-38938139 AGGGGCTCCCAGATTCCTCATGG - Intergenic
1054628860 9:67425813-67425835 AGGGGCTCCCAGATTCCTCATGG + Intergenic
1059525802 9:114989949-114989971 AGGCGCCCCCAGCTCCCTGGGGG - Intergenic
1060754366 9:126201955-126201977 CTGCGTCCCCAGATCTTTCAGGG - Intergenic
1061883583 9:133579784-133579806 TGGCTCCCCCTCATCTCTCAGGG + Intronic
1062319527 9:135984043-135984065 AGTGGCCCCCACATCTCACATGG - Intergenic
1062579306 9:137222414-137222436 CGTCGCCCCCAGTTCTCTCCAGG + Intergenic
1186339559 X:8629517-8629539 TGGTGCTCCCAGATCTCTCTGGG + Intronic
1186460570 X:9745424-9745446 AGGCTGCCAGAGATCTCTCAAGG - Intronic
1194434806 X:93856467-93856489 AGGAGACCCCACATCTCTCATGG - Intergenic