ID: 1017186425

View in Genome Browser
Species Human (GRCh38)
Location 6:151605412-151605434
Sequence GTTCAGCAGGACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 2, 1: 9, 2: 24, 3: 46, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017186425_1017186429 13 Left 1017186425 6:151605412-151605434 CCTACAGTGTGGTCCTGCTGAAC 0: 2
1: 9
2: 24
3: 46
4: 170
Right 1017186429 6:151605448-151605470 ATTTGGCATTTCCTTCAGTCAGG 0: 1
1: 0
2: 2
3: 13
4: 213
1017186425_1017186427 -4 Left 1017186425 6:151605412-151605434 CCTACAGTGTGGTCCTGCTGAAC 0: 2
1: 9
2: 24
3: 46
4: 170
Right 1017186427 6:151605431-151605453 GAACAGATGCCATTCTGATTTGG 0: 1
1: 0
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017186425 Original CRISPR GTTCAGCAGGACCACACTGT AGG (reversed) Intronic
901154398 1:7125699-7125721 GTTCAGCAGGAGCAGCATGTAGG + Intronic
901879660 1:12186276-12186298 GCTCAGCAGGCCCAAACTCTGGG + Intronic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
906538046 1:46562828-46562850 ATTCTGCAGAGCCACACTGTGGG + Exonic
906798279 1:48714620-48714642 TTTCAGAAGGACCACTCTGGTGG - Intronic
908079810 1:60564317-60564339 GTACAGCAGGAACACACAGCAGG + Intergenic
908660915 1:66434349-66434371 GCTGAGCAGGACCATCCTGTAGG + Intergenic
911466963 1:98267131-98267153 GTTCATCATGACTACACTGATGG + Intergenic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916048981 1:161021592-161021614 TTTCTGCAGGACCAAACTGCAGG - Intronic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918719019 1:187828696-187828718 GTTCATGAGGACAAGACTGTGGG - Intergenic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1063098853 10:2932317-2932339 GGTCAGCAGGACCACTCTCATGG + Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075670335 10:124260116-124260138 GTTGAGTAGGAGCCCACTGTGGG - Intergenic
1076757672 10:132581589-132581611 GTGCAGTGGGACCTCACTGTAGG + Intronic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1079888950 11:26026078-26026100 CTACAGCAGGATCTCACTGTAGG + Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081742090 11:45448014-45448036 GTTCAGCAGAAAGACACTGGAGG + Intergenic
1084447185 11:69210416-69210438 GATAGGCAGGGCCACACTGTGGG + Intergenic
1084769856 11:71335537-71335559 GTTCAGAAGGACCAAAGGGTGGG - Intergenic
1087202238 11:95357448-95357470 GTTCAGCTGGACCAAAATTTTGG + Intergenic
1087411278 11:97792851-97792873 GTCCAGCATCACTACACTGTAGG - Intergenic
1089310679 11:117556283-117556305 GTCCAGCAGGTACAGACTGTGGG + Intronic
1090201312 11:124859442-124859464 GTTCACCAGGTACCCACTGTGGG - Intergenic
1091865958 12:3837128-3837150 ATTCAGCAACACCACATTGTAGG + Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095206942 12:39449121-39449143 GTTCAGAAGGGCCACACTCTTGG - Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103138468 12:118527981-118528003 GTTGAGCAAGTCCACCCTGTGGG + Intergenic
1103726703 12:123000787-123000809 GTTCAGCTGCTCCACACTGGAGG + Exonic
1106192532 13:27466306-27466328 CTTCAGCAGGACCACAGTGGAGG + Intergenic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108560959 13:51643536-51643558 GTTCATCAATACCACCCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1111014694 13:82363978-82364000 GTTGAGCAGGACGATACTTTGGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112210536 13:97373001-97373023 GTTCAGCAAGGCCCCAGTGTGGG + Intronic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1117351214 14:54883741-54883763 GTTCAGCAAGGCCAAACAGTGGG + Intronic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1128308585 15:66616298-66616320 CTTGATCAGGACCACACAGTTGG - Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1135465836 16:22684086-22684108 GTGCAGCAGGACCACTCATTAGG + Intergenic
1137394147 16:48105174-48105196 CTTCACCAAGACCACACTGATGG - Exonic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1139551538 16:67675752-67675774 GGTCAGCAGGTCCACAATGTAGG + Exonic
1139636735 16:68262736-68262758 GTTCCTCAGGACCACCCTGCAGG - Intergenic
1141269121 16:82522863-82522885 GAGCAGGAGGAGCACACTGTGGG + Intergenic
1141748817 16:85944737-85944759 GATCAGCAGGTCCATCCTGTGGG + Intergenic
1143163356 17:4885500-4885522 GCTCAGCTGGACCGCACCGTGGG + Exonic
1143340814 17:6209595-6209617 GCTCACTATGACCACACTGTGGG + Intergenic
1143729132 17:8870483-8870505 GGTCTGCAGGACCACAGTATTGG + Intergenic
1144762758 17:17716766-17716788 GTCCAGCAGCACCACACAGGAGG - Intronic
1145228073 17:21147856-21147878 GCTCAGCAACACAACACTGTAGG + Intronic
1145909278 17:28533276-28533298 GTTCAGCAGGGGCTGACTGTGGG - Intronic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1152642834 17:81456352-81456374 TTTCAGCTGGGCCACCCTGTGGG - Exonic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155121600 18:22826469-22826491 ATTCAACAGGACCTCAATGTAGG + Intronic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1158482550 18:57834896-57834918 GATCACCAGGACCACACAGTAGG - Intergenic
1158488427 18:57888966-57888988 CATCAGCAGGCCCACACTCTAGG + Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1159906354 18:74096293-74096315 GTTCAGTAGCACCACACTACAGG + Intronic
1160429094 18:78799245-78799267 TTTCACCAGCACCACACTGCTGG + Intergenic
1160494755 18:79366336-79366358 GAACCGCAGAACCACACTGTGGG + Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162496454 19:11025780-11025802 ACGCAGCAGGACCCCACTGTGGG - Intronic
1163456099 19:17406536-17406558 TTTCAGCAGGGCCAGACAGTAGG + Intronic
1164419648 19:28077766-28077788 GAGCAGCAGGGCCACACTCTTGG - Intergenic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
1168186858 19:54705606-54705628 GTTCTCCAGGATGACACTGTGGG + Intergenic
925240073 2:2317302-2317324 TATCAGCAGGACCACACCGACGG - Intronic
926248960 2:11142389-11142411 GTCCAGCAGGTCCACAATGCAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927138634 2:20114947-20114969 TTTCACCAGGACCCCACGGTGGG - Intergenic
927888812 2:26735539-26735561 GATCATCAGAACAACACTGTGGG + Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932799774 2:74730796-74730818 TTAGAGCAGCACCACACTGTAGG - Intergenic
933833303 2:86227383-86227405 GAGCAGCAGGTACACACTGTGGG + Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941365555 2:164606690-164606712 GATCAGCTGGAACACTCTGTAGG - Intronic
941805753 2:169710822-169710844 GTTCAGAAGGACCCCACTCTTGG - Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943898019 2:193392616-193392638 GTTAAGCTGGGGCACACTGTGGG + Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946926171 2:224629444-224629466 GTTCACCAGGAACACGATGTGGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
948881639 2:240860781-240860803 GTTCTGCAGGACCCCCTTGTTGG - Intergenic
1169575162 20:6951488-6951510 GCACAGCAGGACTTCACTGTGGG - Intergenic
1170432996 20:16294432-16294454 GCTGAGCAGGTCCCCACTGTGGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1173456747 20:43208713-43208735 GTCCAGAAGGAACTCACTGTGGG - Intergenic
1174274211 20:49391859-49391881 GTGCAGCAGGACACCACTGGAGG - Intronic
1175465236 20:59186157-59186179 GTCCAGCAAGTCCCCACTGTGGG - Intergenic
1176246098 20:64097855-64097877 CGTCAGCAGGACCAGAGTGTCGG - Exonic
1177284437 21:19030880-19030902 TTTTAACAAGACCACACTGTGGG + Intergenic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1179784874 21:43723876-43723898 GTGCTGCAGGACCACAGTGCAGG + Intronic
1180109305 21:45640660-45640682 CTTCAGCAGGACTACACTCCAGG - Intergenic
1182815063 22:33155166-33155188 TTTCAGCAGCACCCCACTCTTGG - Intergenic
1183811814 22:40264081-40264103 ATTCAGCAGGAAAACACAGTAGG + Intronic
1185230318 22:49676961-49676983 GATCAGCAGGAGGCCACTGTGGG - Intergenic
949665161 3:6330836-6330858 TTTCAGCAGTACCCCACTGCTGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
953999123 3:47542361-47542383 GACCAGCAGGAGCACACTGCAGG - Intergenic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
958434707 3:94082248-94082270 GATCCCCAGGACCACACTTTGGG - Intronic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963404116 3:144840659-144840681 CTTCAGCAGCATCACACTATAGG - Intergenic
964374806 3:156039117-156039139 GTTTAGCAGGACAAGTCTGTTGG + Intronic
964537124 3:157735175-157735197 GTTCAGCAGCTTCACACAGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
968265471 3:197359659-197359681 TTTCAGCAGCACCCCACTCTTGG - Intergenic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970624518 4:17862101-17862123 TTTCAGCAGCACCCCACTCTTGG + Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
977033892 4:91924880-91924902 GTTCATCATGCCCACACTGCTGG - Intergenic
978969068 4:114780532-114780554 GTTCAATAGCACCACACTATAGG - Intergenic
979129442 4:117022814-117022836 GTGCAGCAAGCCCATACTGTGGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
980955652 4:139426953-139426975 GGTCAGCAGGTCCACGATGTAGG + Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983129931 4:164005775-164005797 GTTTGGCAGCACCACATTGTAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984181561 4:176489477-176489499 TGTCAGCAGGACCACATTCTAGG + Intergenic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992313003 5:75521962-75521984 GTTCGGCAGGACCACTAGGTAGG - Intronic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993187741 5:84641769-84641791 GTTCAGGATGAGCACACTTTGGG - Intergenic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995220265 5:109640528-109640550 TTTCAGCAGCACCTCACTCTTGG - Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997164583 5:131646191-131646213 ATTCTGTAGTACCACACTGTTGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001426485 5:171625919-171625941 GGTCCTCAGGACCACACTGTTGG - Intergenic
1002405611 5:179027823-179027845 TCTCAGCAGGAACACCCTGTGGG - Intronic
1002664575 5:180813527-180813549 GTACAGCAAGACCAGACTTTTGG - Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003590867 6:7435581-7435603 ATTTAGCAGTACGACACTGTAGG + Intergenic
1006613673 6:35310872-35310894 GTTCTGCTGGTCCTCACTGTAGG + Intronic
1010253811 6:73735363-73735385 TTTCAGATGGATCACACTGTTGG + Intronic
1012939445 6:105402212-105402234 GATCAGCACGGCCACACTATGGG + Intronic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014735559 6:125092098-125092120 GTCCAGCAGGACCTACCTGTTGG - Exonic
1015116980 6:129660532-129660554 ATTCAGCAGGTCCAAACTGAGGG - Intronic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1020466161 7:8482101-8482123 GTTCAGCAGTTTCACTCTGTTGG - Intronic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1023060327 7:36320543-36320565 TTTCAGCAGCACCCCACTGCTGG - Intergenic
1024759512 7:52577930-52577952 GCTCACCAGGAGCACCCTGTTGG - Intergenic
1027603046 7:80263343-80263365 GTTCAACAAGACGACACTGTGGG + Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1031001525 7:116420975-116420997 GTTTAGCAGGTCCACACTTCTGG - Intronic
1033510511 7:142056061-142056083 GTTCAGCAGGAGCACTCCATGGG - Exonic
1033513357 7:142082536-142082558 GTTCAGCAGGAGCACTCCATGGG - Intronic
1034087376 7:148332514-148332536 GTTCAGAAGGGCCACGCTCTGGG - Intronic
1034681757 7:152934168-152934190 TTTCGGCAGCACCACAATGTCGG - Intergenic
1034878797 7:154748433-154748455 GCTCACCAGGAGCACAGTGTGGG - Intronic
1040616881 8:49046292-49046314 GGTCACCAGAACCACACTGGAGG + Intergenic
1041965029 8:63666647-63666669 GTTCAGCAGTACCCCACTTCTGG - Intergenic
1042448541 8:68918240-68918262 AATCAGCAGGACCTCCCTGTGGG + Intergenic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1044191515 8:89324227-89324249 GTCCAGTAGGAGCACACTGGAGG - Intergenic
1046941092 8:119932316-119932338 GATCTGCATAACCACACTGTGGG + Intronic
1047476657 8:125238851-125238873 GTTCTGCAGTAAGACACTGTGGG + Intronic
1048133538 8:131723295-131723317 GTTCAGCTAAACTACACTGTTGG + Intergenic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055113806 9:72586169-72586191 GTTCTACAGGCCCACACAGTAGG + Intronic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056499781 9:87197443-87197465 AATCAGCAGGGTCACACTGTGGG + Intergenic
1057223392 9:93270124-93270146 CTTCAGCAGGACCACCCTCAGGG - Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1057330480 9:94110002-94110024 GTTCAGCATGACCAAACACTGGG + Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061323662 9:129849011-129849033 GTTCAGCAGGCCCAGGCTGCAGG - Intronic
1062573532 9:137196210-137196232 GTCTAGCAGGACCTGACTGTGGG - Intronic
1186426743 X:9468498-9468520 CCGCAGCAGGACCACACTCTGGG - Intronic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1189055422 X:37694521-37694543 ATGCAGCAGGACGTCACTGTTGG + Exonic
1190498193 X:51047997-51048019 GTTTAACAGCACCACACAGTGGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1193425700 X:81338252-81338274 GTTGAGCAGGGCCAGACTGCAGG - Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196739851 X:119015274-119015296 GGTAAGCAGGACCAGACTTTTGG - Intronic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1198303861 X:135360384-135360406 GATCAGCAGAACCCCACTCTGGG + Exonic