ID: 1017186862

View in Genome Browser
Species Human (GRCh38)
Location 6:151610371-151610393
Sequence TCTAAGCTGTAGAAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017186859_1017186862 20 Left 1017186859 6:151610328-151610350 CCCAACTTCTTGTTTTGAAAATA 0: 1
1: 0
2: 8
3: 95
4: 832
Right 1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 263
1017186857_1017186862 26 Left 1017186857 6:151610322-151610344 CCCTTTCCCAACTTCTTGTTTTG 0: 1
1: 0
2: 5
3: 104
4: 891
Right 1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 263
1017186860_1017186862 19 Left 1017186860 6:151610329-151610351 CCAACTTCTTGTTTTGAAAATAT 0: 1
1: 0
2: 6
3: 105
4: 855
Right 1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 263
1017186858_1017186862 25 Left 1017186858 6:151610323-151610345 CCTTTCCCAACTTCTTGTTTTGA 0: 1
1: 0
2: 6
3: 264
4: 5299
Right 1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017186862 Original CRISPR TCTAAGCTGTAGAAAATGGC AGG Intronic
901222620 1:7592193-7592215 TCTAAACTGTGAAAAGTGGCTGG - Intronic
901872490 1:12146125-12146147 TCTGAGCTGCAGAGAATGGCAGG - Intergenic
902179515 1:14677420-14677442 TCCAAGCTGTAGAAATTGACTGG + Intronic
902821484 1:18945995-18946017 TCTAAGCTGTCTAACATAGCAGG + Intronic
906490440 1:46264090-46264112 ACTAAGGAGTAGAAAAAGGCTGG - Intronic
907768164 1:57431820-57431842 TAAAAGCTATAAAAAATGGCTGG + Intronic
908024399 1:59935092-59935114 TCCATGTTGTTGAAAATGGCAGG - Intergenic
908973782 1:69870752-69870774 TCTAAGAGGTGGAAAATGGAGGG - Intronic
909619041 1:77646805-77646827 TCTAAGCTGCAGAGAAAGGAAGG + Intronic
910384915 1:86671896-86671918 TCTAAGTTGTTGCAAATGACAGG - Intergenic
911414601 1:97555864-97555886 TCTAATTTGTAGAGAGTGGCTGG - Intronic
911530206 1:99035415-99035437 TCTATGCTGTTGCAAATGGCAGG - Intergenic
912618319 1:111129923-111129945 TCTAGGGTGTAGAAACTGGAAGG + Intronic
913124621 1:115773458-115773480 TCTAAGAGGTAGAAAAGGCCAGG + Intergenic
915395582 1:155581259-155581281 TTTAAAATGTAGATAATGGCTGG - Intergenic
915536075 1:156536306-156536328 TCTATGTTGTCGAAAATGACAGG - Intronic
915894604 1:159802142-159802164 TTGAAGCTGCAGAAAATGTCAGG + Intronic
917697683 1:177543609-177543631 TGTCAGCTGTAGAAAAGAGCTGG + Intergenic
918225901 1:182482952-182482974 TCTATGTTGTTGCAAATGGCAGG - Intronic
918311430 1:183288188-183288210 TCTGAGAAGTAGAAAATGGCTGG + Intronic
920690542 1:208143204-208143226 TTTAAGCTGAAGAAGATGCCTGG - Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
923109114 1:230876918-230876940 TCTTAGCTGAAGATAAGGGCAGG + Intergenic
923935568 1:238756272-238756294 ACAAAGCTGTAGAAAATCTCAGG + Intergenic
924209812 1:241753104-241753126 TCAAAGCTTTAAAAAATGGAAGG + Intronic
1063550208 10:7025358-7025380 TCTATGTTGTAGCAAATGACAGG - Intergenic
1065962745 10:30747281-30747303 CCTAAGCTGGGGAAAAAGGCAGG + Intergenic
1069118909 10:64543929-64543951 TCTATACTATAGCAAATGGCAGG - Intergenic
1072398790 10:95074518-95074540 TCTAAGTTGTTGCAAATGACTGG + Intergenic
1073740122 10:106397240-106397262 TCTAACCTGTAGAAACCAGCTGG + Intergenic
1073862395 10:107762265-107762287 TCTATGCTGTTGCAAATGGCAGG - Intergenic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1074787405 10:116852997-116853019 ACAAAGCAGTAGATAATGGCCGG + Intronic
1075797459 10:125130897-125130919 TCCAAGCTGGAGAAAATCCCTGG + Intronic
1076876074 10:133216254-133216276 TCTCACCTGAAGAAAATGGGGGG + Intronic
1077597766 11:3548740-3548762 TCTATGTTGTTGAAAATGACAGG - Intergenic
1077980848 11:7299507-7299529 TTTAAATTGTAGCAAATGGCAGG - Intronic
1078644182 11:13123863-13123885 TCTAAGGTGTTGAAATTGGCAGG + Intergenic
1080392963 11:31865329-31865351 CCTAACCAGGAGAAAATGGCAGG + Intronic
1082753117 11:57044220-57044242 TCCATGCTGTTGCAAATGGCAGG - Intergenic
1083758628 11:64804160-64804182 TCTGAGCTGGAGAAAATCGTGGG + Exonic
1084253854 11:67924649-67924671 TCTATGTTGTTGAAAATGACAGG - Intergenic
1084669052 11:70594648-70594670 TCTAAGGTGAGGAAAATGACTGG + Intronic
1084763283 11:71288068-71288090 TCCATGCTGTTGCAAATGGCAGG + Intergenic
1084819024 11:71671277-71671299 TCTATGTTGTTGAAAATGACAGG + Intergenic
1086723794 11:90156358-90156380 TCTAAGAAATAGAAACTGGCTGG - Intronic
1087138437 11:94742774-94742796 TCTAAGATCAAGAAACTGGCAGG + Intronic
1090845469 11:130526504-130526526 TCCATGTTGTCGAAAATGGCAGG + Intergenic
1090916205 11:131165280-131165302 TCTATGCTGTTCCAAATGGCAGG + Intergenic
1091795570 12:3295764-3295786 TCCAAGCTGCAGAAAGTGGTAGG - Intergenic
1092423925 12:8358037-8358059 TCTATGTTGTTGAAAATGACAGG - Intergenic
1092437043 12:8457378-8457400 TCTGTGCTGTTGCAAATGGCAGG + Intronic
1092646246 12:10576225-10576247 TTTTAGCTGTAGAAATGGGCGGG + Intergenic
1092839901 12:12529839-12529861 TCCATGTTGTAGAAAATGACAGG + Intronic
1095569019 12:43660829-43660851 GCTAAGCTGAAGAAAAAGACTGG + Intergenic
1096641795 12:53000689-53000711 TCCATGCTGTCAAAAATGGCAGG + Intergenic
1097551787 12:61080648-61080670 TCAAAGCTTTAGAAAATGGAAGG + Intergenic
1098072452 12:66690319-66690341 TCTATATTGTAGTAAATGGCAGG + Intronic
1098313663 12:69171837-69171859 TGTATGCTGAACAAAATGGCTGG - Intergenic
1098817954 12:75192016-75192038 TCTGAGCTGTGGCAAATAGCAGG - Intronic
1099125332 12:78748484-78748506 TCCATGCTGTTGAAAATGACAGG - Intergenic
1099418162 12:82420046-82420068 TCCATATTGTAGAAAATGGCAGG - Intronic
1099931360 12:89079060-89079082 TCCATGTTGTGGAAAATGGCAGG + Intergenic
1100917095 12:99436645-99436667 TCTAAACTGTTAATAATGGCAGG + Intronic
1101888055 12:108686416-108686438 TCTAAGCTTTAGAAGATTGGTGG - Intronic
1103459801 12:121094683-121094705 TCCAGGCTGTTGGAAATGGCAGG - Intergenic
1105730171 13:23205923-23205945 ACTAAGCTACAGAAAATGCCAGG + Intronic
1106280381 13:28262711-28262733 AACAAACTGTAGAAAATGGCTGG + Intronic
1107414957 13:40191857-40191879 TTTATGCTGTAGAAGATGCCAGG + Intergenic
1109244063 13:59931084-59931106 TTTAAGCTGAAGAAAATAGTTGG - Intronic
1110045312 13:70821375-70821397 TCTAACCTCAAGAAATTGGCAGG + Intergenic
1110778352 13:79435796-79435818 TCCAGGTTGTGGAAAATGGCAGG - Intergenic
1111067417 13:83113414-83113436 TCTATGCTGTTGCAAATGTCAGG + Intergenic
1111336327 13:86828982-86829004 TCCAAGTTGTTGCAAATGGCAGG + Intergenic
1112931749 13:104748660-104748682 TGTAAGCTTTAGAAACTGGGCGG - Intergenic
1114596398 14:23915872-23915894 TCTATGTTGTAAAAAATGGATGG - Intergenic
1116004987 14:39283046-39283068 TCCATGTTGTAGCAAATGGCAGG + Intronic
1116555210 14:46294382-46294404 TCCATGTTGTTGAAAATGGCAGG + Intergenic
1117318826 14:54601087-54601109 GCTCAGCAGTAGAAAATGGATGG + Intronic
1117966134 14:61208650-61208672 TTTAAGCTATAGAAAATGCCTGG - Intronic
1118116945 14:62789234-62789256 TCCATGCTGTGGCAAATGGCAGG + Intronic
1120870641 14:89334085-89334107 TCCATGCTGTCAAAAATGGCAGG - Intronic
1120937974 14:89917396-89917418 TCCATGCTGTTGCAAATGGCAGG + Intronic
1121182668 14:91941469-91941491 CCGAAGCTGTAGAAAAGGCCAGG - Intronic
1121771500 14:96546866-96546888 CCTAAGCAGCAGAAAATGCCTGG - Intronic
1122203456 14:100136447-100136469 TCTAAGCTGTGGCAGATGGGAGG + Intronic
1123500276 15:20875801-20875823 TCCATGCTGTCAAAAATGGCAGG - Intergenic
1123557522 15:21449494-21449516 TCCATGCTGTCAAAAATGGCAGG - Intergenic
1123593749 15:21886775-21886797 TCCATGCTGTCAAAAATGGCAGG - Intergenic
1127031541 15:54869877-54869899 TCTATGTTGTTGAAAATGGCAGG - Intergenic
1127629574 15:60814568-60814590 TCCAAGCCGAAGAAAATGGATGG + Intronic
1128764814 15:70244568-70244590 TCTGAGCTGGAGAGTATGGCTGG - Intergenic
1128900436 15:71416155-71416177 TCTATGCTGTTGCAAATGACAGG + Intronic
1129908989 15:79210276-79210298 TGTCAGCTGAAGAAAATGTCTGG - Intergenic
1131879529 15:96847862-96847884 TCCATGTTGTTGAAAATGGCGGG - Intergenic
1132270605 15:100520685-100520707 GGTAAGGTGTAGAAAATGACAGG + Intronic
1202965872 15_KI270727v1_random:176666-176688 TCCATGCTGTCAAAAATGGCAGG - Intergenic
1133374349 16:5271903-5271925 TCTATGTTGTTGAAAATGACAGG + Intergenic
1134459233 16:14417387-14417409 TCTAAGCAATAGACTATGGCTGG - Intergenic
1135508828 16:23063459-23063481 TAAAATCTATAGAAAATGGCAGG + Exonic
1137226257 16:46513534-46513556 TCTATGCTGTTGCAAATGACAGG - Intergenic
1137506995 16:49062817-49062839 TCTCAGCTTTAGATAATGGCAGG - Intergenic
1138105954 16:54287187-54287209 CCTAAGCTGCTGAAAGTGGCCGG - Intergenic
1140607386 16:76556098-76556120 TCTAAGATGTAGAACATAGGGGG - Intronic
1141827080 16:86488107-86488129 TCTAAGCTGGATAAAAAGCCAGG + Intergenic
1145102662 17:20089755-20089777 TCTGTGCTGGAGAAAAAGGCAGG + Intronic
1149986437 17:61350958-61350980 TCCAAGTTGTGGCAAATGGCAGG - Intronic
1151165123 17:72196859-72196881 TCAAAGCCAGAGAAAATGGCAGG + Intergenic
1153293570 18:3524364-3524386 TCTATGTTGTGGCAAATGGCAGG - Intronic
1155089365 18:22491423-22491445 TCCAAGTTGTGGCAAATGGCAGG + Intergenic
1155417137 18:25611272-25611294 TCCATGTTGTAGCAAATGGCAGG - Intergenic
1159549020 18:69875748-69875770 TCCATGCTGTCGCAAATGGCAGG - Intronic
1159582935 18:70253144-70253166 TTTCAGCTGTATAAAATGGACGG - Intergenic
1160056946 18:75492240-75492262 TCTAAACAGTAGGAGATGGCTGG + Intergenic
1160145261 18:76358710-76358732 TCCAAGCTGTAGAAAAAGGAAGG - Exonic
1162256782 19:9496956-9496978 TCTACGTTGTTGAAAATGACAGG - Intronic
1164959644 19:32416859-32416881 TCTAAGGAGCAGAAAAGGGCTGG - Intronic
1166865604 19:45834947-45834969 GCTAAGGTGTAGATAATGACAGG - Intronic
1167787940 19:51651194-51651216 TCAAAACTGTAGGAGATGGCGGG + Intergenic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925848527 2:8056433-8056455 TCTAAGTTGTTGCAGATGGCAGG + Intergenic
928586498 2:32763865-32763887 TGAAAGCTGAAGAAAATGGGAGG + Intronic
930635636 2:53802714-53802736 TCTAAGCTGTTCAAAACAGCTGG - Intronic
932525850 2:72467138-72467160 TCCATGCTGTTGCAAATGGCAGG + Intronic
932993926 2:76825306-76825328 CCTAAGCTAGAGATAATGGCTGG + Intronic
933269423 2:80217126-80217148 TCTAAGAAGTAGAAATAGGCTGG - Intronic
937286294 2:120754481-120754503 TATAAGCTCTGGAAAATGACAGG - Intronic
937817322 2:126265985-126266007 TCCATGCTGTAGAAAATGTCAGG + Intergenic
938811207 2:134854521-134854543 TCTAAGATGTTGAACATGACTGG - Intronic
939017838 2:136921904-136921926 TCTAAGCTGTAAAGAAAGGTTGG + Intronic
939065963 2:137483707-137483729 TCTAACAAGTAGAAAATGGGAGG + Intronic
939371237 2:141303592-141303614 TCTATGTTGTAGCAAATGACAGG + Intronic
939561857 2:143741920-143741942 TCTAAGTTATAGAAAAAGGAAGG + Intronic
940528953 2:154855008-154855030 TCTAAGCTGCAGAAAATTACTGG + Exonic
943551734 2:189349009-189349031 TCAAAGCTGTATAACATAGCTGG + Intergenic
943877970 2:193098234-193098256 TCTATGCTGTCACAAATGGCAGG + Intergenic
947486873 2:230558452-230558474 TATAAGATTTATAAAATGGCAGG + Intergenic
947808749 2:232986539-232986561 TCCATGCTGTTGCAAATGGCAGG - Intronic
947881650 2:233519696-233519718 ACTAAGTTGTAAAAAATGGGAGG + Intronic
948397284 2:237655008-237655030 TCCATGCTGTTGAAAATGACAGG - Intronic
1170336605 20:15277104-15277126 TCTAACTGGTTGAAAATGGCAGG - Intronic
1171170787 20:23013751-23013773 TCAAATCGGTAGAAATTGGCAGG + Intergenic
1172836376 20:37875868-37875890 TCTGTGCTGGGGAAAATGGCAGG + Intergenic
1176961558 21:15164578-15164600 TCTGTGTTGTAGGAAATGGCAGG + Intergenic
1177049053 21:16209059-16209081 TCTAAGCAGCAGCAAAAGGCTGG + Intergenic
1177401392 21:20610300-20610322 TCCATGTTGTTGAAAATGGCTGG - Intergenic
1179244188 21:39616099-39616121 TTTAAGCTGTAGACACAGGCAGG + Intronic
1182638040 22:31744613-31744635 TCTAAGCTCTAGAATATTGATGG - Intronic
1182721399 22:32403982-32404004 TCCATGCTGTAGTAAATGGCAGG + Intronic
1184059332 22:42072716-42072738 TCTGAGATGTGGAAAGTGGCCGG - Intergenic
949191554 3:1255491-1255513 TAAAAGCTGGAGAAATTGGCAGG + Intronic
950752686 3:15143141-15143163 TCTATGTTGTTGAAAATGACAGG + Intergenic
951490195 3:23261769-23261791 TCCAATGTGTAGCAAATGGCAGG + Intronic
952547904 3:34441503-34441525 TCCAAGTTGTTGCAAATGGCAGG + Intergenic
952583060 3:34857232-34857254 TATAACCTGTAGAAAATAGTAGG + Intergenic
954704955 3:52474758-52474780 GCTAAGCTGTGGCAAGTGGCGGG + Intronic
955103474 3:55874264-55874286 TCTAGGCTGAAGAATAAGGCGGG + Intronic
955307033 3:57844079-57844101 TCTAATCATTAGAAAATGGTTGG - Intronic
955653412 3:61218806-61218828 TCTAAGCTCTATAAAATGTATGG + Intronic
957937754 3:86966225-86966247 TCTAAGCTGTATAACAAGGAAGG + Intronic
960801139 3:121541826-121541848 TCGAAGTTGAAGAAAAGGGCTGG + Intronic
961097477 3:124169982-124170004 TCTAAGGTGGAGAAGAGGGCTGG + Intronic
961718226 3:128873478-128873500 TCTAGGCTGTAGACAAAAGCAGG - Intergenic
963605901 3:147411390-147411412 TCGAAGCCGGAGAAAGTGGCTGG + Intronic
964331030 3:155603225-155603247 TCTAATCTGTGGAAGCTGGCAGG - Intronic
967141230 3:186562369-186562391 TCCATGTTGTTGAAAATGGCAGG - Intronic
969741584 4:9032037-9032059 TCTATGTTGTTGAAAATGACAGG + Intergenic
969800953 4:9564942-9564964 TCTATGTTGTTGAAAATGACAGG + Intergenic
970446548 4:16127553-16127575 TCTTAGCTCAGGAAAATGGCAGG - Intergenic
972098219 4:35376873-35376895 TCTATGTTGTTGCAAATGGCAGG - Intergenic
972769948 4:42188395-42188417 TCTATGTTGTTGTAAATGGCAGG - Intergenic
973031214 4:45342824-45342846 TCCATGTTGTAGCAAATGGCAGG + Intergenic
973061995 4:45738394-45738416 TCTATGTTGTTGCAAATGGCAGG + Intergenic
973967342 4:56177124-56177146 TCTAAGCTCTAGAACAAGACAGG - Intronic
974887564 4:67839224-67839246 TCTAAGCTTCAGAAATTAGCTGG + Intronic
975361852 4:73479606-73479628 TGTGATGTGTAGAAAATGGCAGG - Intergenic
975649286 4:76576334-76576356 TCTATGTTGTTGCAAATGGCAGG - Intronic
977457548 4:97280747-97280769 TCCATGCTGTTGCAAATGGCTGG - Intronic
978915314 4:114119092-114119114 TCCATGTTGTCGAAAATGGCAGG + Intergenic
979549535 4:121975457-121975479 TCTAAGTTGTAGGAAAAGGGGGG + Intergenic
980064286 4:128166875-128166897 TCCATGTTGTAGCAAATGGCAGG + Intronic
982932144 4:161421835-161421857 TCAAATCTTTAGAAAATGGCTGG + Intronic
982939467 4:161531361-161531383 TCTATTATGTAGAAAATAGCTGG + Intronic
983044053 4:162964834-162964856 TCTAAGATTTAAAAAATGGTAGG - Intergenic
984078960 4:175218725-175218747 TCTATGTTGTGGCAAATGGCAGG + Intergenic
985032271 4:185801182-185801204 TGTATGCTGTTGCAAATGGCAGG + Intronic
986273084 5:6251018-6251040 TCTATGTGGTGGAAAATGGCAGG + Intergenic
987134782 5:14890378-14890400 TCTCAGCTGTGGTGAATGGCGGG + Intergenic
987233758 5:15922210-15922232 TCTATATTGTGGAAAATGGCAGG - Intronic
987736442 5:21849986-21850008 TCCATGTTGTAGCAAATGGCAGG - Intronic
987772837 5:22329418-22329440 TCTAACCACTAGAATATGGCAGG + Intronic
988485288 5:31663544-31663566 TCTGTGCTGTTGAAATTGGCAGG + Intronic
989207274 5:38823456-38823478 TCCAAGTTGTTGCAAATGGCAGG - Intergenic
989553732 5:42766596-42766618 TCTATGTTGTTGCAAATGGCAGG - Intronic
997387180 5:133482774-133482796 CCTCAGCTGTACAAATTGGCAGG + Intronic
997898435 5:137740989-137741011 GATAAGCTGTAGAAGAAGGCTGG - Intergenic
998288417 5:140886928-140886950 TCTAATGTGTAGAACATGCCTGG - Intronic
998651968 5:144130973-144130995 TATAGGCTGTAGTGAATGGCAGG + Intergenic
1000890708 5:166798563-166798585 TCCATGCTGTTGCAAATGGCTGG + Intergenic
1000970229 5:167705918-167705940 TCCATGCTGTTGCAAATGGCAGG + Intronic
1001439369 5:171727727-171727749 TCTAATCTGTAGAAAAGAGAGGG + Intergenic
1003530372 6:6931798-6931820 TCTTAGCTGTAGAAAAAGAGAGG - Intergenic
1006278768 6:33029363-33029385 TCCAAACAGTAGAATATGGCTGG - Intergenic
1007067658 6:39008189-39008211 GCTAAGTTCTAGAATATGGCAGG - Intronic
1009661553 6:66618910-66618932 TCTATGCTGTTGAAAATGACAGG - Intergenic
1009907315 6:69885782-69885804 TCTATGCTGTGGAAAATGGAAGG + Intronic
1010522239 6:76851897-76851919 TCTAAGTTGTGGCAAATGACAGG - Intergenic
1010692495 6:78926852-78926874 TCTATGTTGTTGCAAATGGCAGG + Intronic
1010942729 6:81937877-81937899 TCTAAGTTGTAGAAACTGAGTGG + Intergenic
1011099391 6:83706001-83706023 TCTAAGATGTGGAAAATAGGGGG - Intronic
1012225413 6:96698083-96698105 TCTATGTTGTTGAAAATGACAGG - Intergenic
1012968590 6:105702659-105702681 TCAAAGCTGTTAAAAATGGGAGG + Intergenic
1014102157 6:117523236-117523258 TCTAAACACTACAAAATGGCTGG - Intronic
1014619607 6:123649492-123649514 TCCATGTTGTAGCAAATGGCAGG - Intergenic
1016625972 6:146169661-146169683 TCTAGGCTGCAGAACAGGGCGGG - Intronic
1016679956 6:146817565-146817587 TCTATGTTGTTGCAAATGGCAGG - Intergenic
1017186862 6:151610371-151610393 TCTAAGCTGTAGAAAATGGCAGG + Intronic
1018444811 6:163846020-163846042 TCCATGCTGTAGGAAATGGAAGG + Intergenic
1018789264 6:167134050-167134072 TCTAAGCTGCAGAGCATGGCAGG - Intronic
1020876631 7:13703190-13703212 TCTAAGAAGTACAAAAGGGCTGG - Intergenic
1020878744 7:13731742-13731764 TCAAAACAGTAGAAAATTGCAGG + Intergenic
1021809681 7:24391349-24391371 ACTAAGGTGTGGAAAATGGTAGG - Intergenic
1022652245 7:32287904-32287926 TCAAAAATGTAGAAACTGGCTGG + Intronic
1022661433 7:32370901-32370923 TCTATGCTGGTGCAAATGGCAGG - Intergenic
1023187175 7:37544352-37544374 TCTAAGTTGTCGTAAATGACAGG + Intergenic
1026371789 7:69706917-69706939 TCTAAGCAGTACACAAAGGCTGG + Intronic
1028299099 7:89174399-89174421 TCTATGTTGTTGAAAATGACAGG + Intronic
1028728890 7:94122093-94122115 TATTAGATGTAGGAAATGGCTGG - Intergenic
1030731454 7:112994661-112994683 TCTACGTTGTCAAAAATGGCAGG - Intergenic
1031385428 7:121144370-121144392 TCCATGCTGTTGCAAATGGCAGG - Intronic
1031548410 7:123079112-123079134 TCTAAAATGTCTAAAATGGCAGG + Intergenic
1033446704 7:141429383-141429405 TCTATGTTGTTGCAAATGGCAGG - Intronic
1035084059 7:156241128-156241150 TCTAAGTTGTAGAGAATCCCTGG - Intergenic
1036246789 8:7124638-7124660 TCTATGTTGTTGAAAATGACAGG + Intergenic
1036254022 8:7189775-7189797 TCTATGTTGTTGAAAATGACAGG - Intergenic
1036363470 8:8097704-8097726 TCTATGTTGTTGAAAATGACAGG + Intergenic
1036887481 8:12569366-12569388 TCTATGTTGTTGAAAATGACAGG - Intergenic
1036895081 8:12627466-12627488 TCTATGTTGTTGAAAATGACAGG - Intergenic
1037653671 8:20864342-20864364 TCTGAGCTTTAGAAACTGGCAGG + Intergenic
1038222091 8:25619889-25619911 TCTAAGATCAAGAAAAAGGCAGG + Intergenic
1038331468 8:26612807-26612829 TTTAAGCTGTAGAAGGAGGCAGG + Intronic
1039253993 8:35698565-35698587 TCTATGTTGTTGAAAGTGGCAGG + Intronic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1041958829 8:63587704-63587726 TCCATGTTATAGAAAATGGCAGG + Intergenic
1042375336 8:68044676-68044698 TCTAAGCTCTAATACATGGCAGG - Intronic
1042981218 8:74531228-74531250 TCCAAGTTGTTGCAAATGGCAGG - Intergenic
1043254082 8:78110895-78110917 TCTTAGCTGTAGAAAATAAAGGG + Intergenic
1043438252 8:80254761-80254783 TCTAGGCTGGAGAGAGTGGCTGG + Intergenic
1043751318 8:83939339-83939361 TCCATGCTGTTGCAAATGGCAGG + Intergenic
1044400389 8:91764095-91764117 TCTAAGATGTAAAAAATGTTAGG - Intergenic
1044741396 8:95330638-95330660 TTCAAGCTGTGGCAAATGGCAGG + Intergenic
1045420442 8:102009395-102009417 TCTACCCTGAATAAAATGGCAGG - Intronic
1045584196 8:103513025-103513047 TATAAGATATAGAAAGTGGCAGG + Intronic
1045730309 8:105231312-105231334 TATAAGCTTCAGAAAATGGTAGG + Intronic
1046312561 8:112457601-112457623 TCTAAAATGTAGAGAATGCCAGG + Intronic
1048773712 8:137922393-137922415 TGTAAGATGCAGAAAATGGAAGG + Intergenic
1050076606 9:1872232-1872254 TCTGACCTGGAGAAAATGTCAGG + Intergenic
1052345386 9:27404240-27404262 TCTATGCTGTTGTAAATGACAGG + Intronic
1052347446 9:27424780-27424802 TCTAATCTGTGGCAAATGGTAGG - Intronic
1055520764 9:77078920-77078942 TATAACCTCAAGAAAATGGCAGG + Intergenic
1055719801 9:79160097-79160119 TCTAAGCTTTAGAAAAAGACTGG - Intergenic
1056697505 9:88872253-88872275 TCTAAGCAGAAGCAAATGTCTGG - Intergenic
1058406181 9:104676995-104677017 TCTTAGCTGTTAAAATTGGCAGG - Intergenic
1058682405 9:107451507-107451529 TCTATGTTGTTGCAAATGGCAGG - Intergenic
1060780706 9:126410389-126410411 ACACAGCTGAAGAAAATGGCTGG - Intronic
1187039878 X:15582539-15582561 TCTACGTTGTTGCAAATGGCAGG - Intronic
1187637074 X:21240951-21240973 TCCATGCTGTTGAAAATGACTGG - Intergenic
1187717339 X:22115745-22115767 TCTATGCTGTTGCAAAAGGCAGG + Intronic
1189264631 X:39704607-39704629 TCTACGCTGTTGCAAATGACAGG - Intergenic
1189862681 X:45289795-45289817 GCTAAGCTGAAGAAAAAGGGAGG - Intergenic
1190124460 X:47691510-47691532 TCTATGTTGTGGCAAATGGCAGG - Intergenic
1190831678 X:54064393-54064415 TCTAGGCTGTAGTACATGCCAGG + Intergenic
1192838594 X:74829357-74829379 TCTACGTTGTTGCAAATGGCAGG + Intronic
1193812193 X:86064811-86064833 TCCATGCTGTGGCAAATGGCAGG + Intergenic
1194157276 X:90406202-90406224 TCTATGTTGTAATAAATGGCAGG + Intergenic
1194419210 X:93651293-93651315 TCTAAGTTGTTGCAAATGACAGG - Intergenic
1194499931 X:94669716-94669738 TCTAAGTTGTTGCAAATGACGGG + Intergenic
1194794952 X:98199953-98199975 TCTAAGCAGTTCAATATGGCTGG - Intergenic
1194931286 X:99890259-99890281 TCTATGTTGTTGCAAATGGCAGG - Intergenic
1198511369 X:137354987-137355009 TCTCAGGTGTTGAGAATGGCAGG - Intergenic
1198585922 X:138122187-138122209 TCTATGCTGTTGCAAATGACAGG + Intergenic
1199049472 X:143220279-143220301 TCTGAGCTGTAGACACTGGTAGG - Intergenic
1199701856 X:150385228-150385250 TCCATGTTGTTGAAAATGGCAGG + Intronic
1200503608 Y:3983190-3983212 TCTATGCTGTAATAAATGGCAGG + Intergenic
1202030207 Y:20563651-20563673 ACTTGGCTGTAGAAAGTGGCTGG - Intergenic