ID: 1017188779

View in Genome Browser
Species Human (GRCh38)
Location 6:151629735-151629757
Sequence CACCATTTATTTATGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017188776_1017188779 4 Left 1017188776 6:151629708-151629730 CCTAACCATAATCTTAATGATAA No data
Right 1017188779 6:151629735-151629757 CACCATTTATTTATGCACCAGGG No data
1017188775_1017188779 5 Left 1017188775 6:151629707-151629729 CCCTAACCATAATCTTAATGATA No data
Right 1017188779 6:151629735-151629757 CACCATTTATTTATGCACCAGGG No data
1017188777_1017188779 -1 Left 1017188777 6:151629713-151629735 CCATAATCTTAATGATAATAGTC No data
Right 1017188779 6:151629735-151629757 CACCATTTATTTATGCACCAGGG No data
1017188774_1017188779 6 Left 1017188774 6:151629706-151629728 CCCCTAACCATAATCTTAATGAT No data
Right 1017188779 6:151629735-151629757 CACCATTTATTTATGCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017188779 Original CRISPR CACCATTTATTTATGCACCA GGG Intergenic
No off target data available for this crispr