ID: 1017191277

View in Genome Browser
Species Human (GRCh38)
Location 6:151655398-151655420
Sequence AAATATCCACAGAGTGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017191274_1017191277 16 Left 1017191274 6:151655359-151655381 CCTAAAGCATATACACAAAACCA No data
Right 1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG No data
1017191276_1017191277 -4 Left 1017191276 6:151655379-151655401 CCAGAAAATAAAAAGATGGAAAT No data
Right 1017191277 6:151655398-151655420 AAATATCCACAGAGTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017191277 Original CRISPR AAATATCCACAGAGTGACAA AGG Intergenic
No off target data available for this crispr