ID: 1017196598

View in Genome Browser
Species Human (GRCh38)
Location 6:151707061-151707083
Sequence GTTGAAGGAGCATTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 455}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017196594_1017196598 19 Left 1017196594 6:151707019-151707041 CCGTGTGTTTAGGTTAGTGAGCG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1017196598 6:151707061-151707083 GTTGAAGGAGCATTGGAGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017196598 Original CRISPR GTTGAAGGAGCATTGGAGGC AGG Intronic
901017336 1:6239505-6239527 GTTCTAGGAGCTTTCGAGGCAGG + Intergenic
901690464 1:10969890-10969912 GGGGGAGGAGCATTGCAGGCAGG + Intronic
901873944 1:12155307-12155329 GGTGATGGAGCAATGGAGGATGG + Intergenic
902913992 1:19624728-19624750 GTGACAGGAACATTGGAGGCTGG + Intronic
902930336 1:19726682-19726704 GTGGGAGGAGCAGAGGAGGCTGG - Intronic
902930414 1:19727107-19727129 GTGGGAGGAGCAGAGGAGGCTGG + Intronic
904190912 1:28742952-28742974 TTTGGAGGAGCAATGGTGGCTGG - Exonic
904641363 1:31933093-31933115 GTGGAAGGATCACTGGAGCCTGG - Intronic
905592093 1:39173044-39173066 GTAGAAAAAGCACTGGAGGCCGG + Intronic
905662309 1:39736970-39736992 GTGGGAGGATCATTTGAGGCTGG + Intronic
907172520 1:52482531-52482553 GTGGAAGGATCACTTGAGGCTGG - Intronic
907538124 1:55184148-55184170 GTGGAAGGATCATTTGAGCCTGG - Intronic
907756725 1:57317826-57317848 GTTGAGGGAGGGTGGGAGGCAGG - Intronic
907947294 1:59147221-59147243 TTTGTTGGAGCCTTGGAGGCAGG - Intergenic
908231911 1:62113540-62113562 GTTGAAGGATCACTTGAGTCTGG + Intronic
908290485 1:62661690-62661712 GTGGAAGGACAATTGGAGTCAGG + Intronic
908461853 1:64354413-64354435 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
908592097 1:65646329-65646351 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
908686904 1:66730851-66730873 GTTGAAACAGTATTCGAGGCAGG - Intronic
909223790 1:72992217-72992239 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
909311519 1:74156233-74156255 GTGGAAGGTGAATGGGAGGCAGG - Intronic
909554357 1:76936825-76936847 GTGGAAGGAGCATTGGACTTTGG + Intronic
909776842 1:79493005-79493027 GGAGAAGGAGCAATGGAGGGTGG + Intergenic
909909818 1:81246702-81246724 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
910353493 1:86327520-86327542 GGAGAAGGAACACTGGAGGCTGG - Intergenic
910562919 1:88611980-88612002 ATAGAAGGAGTCTTGGAGGCTGG - Intergenic
911570260 1:99510902-99510924 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
911620810 1:100064988-100065010 GTGGAAGGATCACTTGAGGCAGG - Intronic
912057531 1:105623219-105623241 TTTGCAGGAGCATTGGAGTCCGG - Intergenic
914825622 1:151136494-151136516 GTTCAAGGAGCAGAGGAGTCTGG - Exonic
915299112 1:154941922-154941944 GCTGAAGGAGCCTGGGAAGCAGG + Intergenic
916142548 1:161712042-161712064 GTAGAAGGAGAAGAGGAGGCGGG - Exonic
917609191 1:176669015-176669037 GTTGAGGGAGGATGGGAGGATGG + Intronic
919163105 1:193857242-193857264 GTTGAAAGAACATGGTAGGCAGG + Intergenic
919906177 1:202079836-202079858 GTTGAAAGAATATAGGAGGCCGG - Intergenic
919982498 1:202650998-202651020 GTGGGAGGGGCATTGGAGCCTGG + Intronic
920907865 1:210188570-210188592 TTTGAAGGAGGAATGGAGGGTGG - Intergenic
921337656 1:214104484-214104506 GTTGAAGGATTGCTGGAGGCTGG + Intergenic
921459924 1:215414388-215414410 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
921759786 1:218899671-218899693 GTGGGAGGATCACTGGAGGCCGG + Intergenic
921855686 1:219980991-219981013 GTAGAAGGATCATTTGAGCCTGG - Intronic
922290665 1:224206589-224206611 GTAGGAGGATCATTGGAGCCTGG - Intergenic
922452588 1:225748820-225748842 GTCCAAAGAGAATTGGAGGCTGG + Intergenic
922906256 1:229175700-229175722 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
923227474 1:231951767-231951789 ATTTAAGGAACATTAGAGGCAGG + Intronic
923244607 1:232119443-232119465 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
923257418 1:232233648-232233670 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
924462339 1:244270558-244270580 GAAGGAGGAGGATTGGAGGCTGG - Intergenic
924813151 1:247420908-247420930 CTGGATGGAGAATTGGAGGCAGG - Intronic
1062775518 10:142934-142956 GGGGCAGGAGCACTGGAGGCGGG + Intronic
1063428346 10:5966668-5966690 GTTCAGTGAGAATTGGAGGCTGG - Intronic
1063509746 10:6634035-6634057 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1063527826 10:6801532-6801554 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1064135988 10:12751345-12751367 ATGGAAGGATCATTTGAGGCAGG - Intronic
1064296652 10:14084812-14084834 GGAGAAGGAGCAGTCGAGGCAGG - Intronic
1064763020 10:18641457-18641479 GTGGAAGGATCATTTGAGCCTGG - Intronic
1066962702 10:42235834-42235856 GTTGTAGGAGCCTTGTAGGGAGG - Intergenic
1067323250 10:45242145-45242167 GTTGAAAGAGCACTGAACGCTGG - Intergenic
1067660537 10:48233768-48233790 GATGAAGGGGCAGGGGAGGCTGG - Intronic
1068230828 10:54168020-54168042 GTAGAAGGAGGAATGGAGGGTGG - Intronic
1068592483 10:58865445-58865467 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1070125014 10:73614106-73614128 GTGGAAGGATCATTTGAGCCCGG + Intronic
1070707885 10:78654827-78654849 GTTCAGGGACCATTGGAGGAAGG + Intergenic
1071265691 10:83962929-83962951 AGAGAAGGAGCATTGCAGGCAGG + Intergenic
1073013503 10:100380127-100380149 GTGGAAGGAGCACTTGAGCCTGG + Intergenic
1073132949 10:101202110-101202132 GCAGAAGGAGAATAGGAGGCTGG - Intergenic
1073496745 10:103898616-103898638 ACTGAAGGAGGAGTGGAGGCAGG - Intronic
1073537796 10:104293647-104293669 GTGGAAGGATCACTTGAGGCTGG - Intronic
1074733318 10:116400839-116400861 GATGAAGGAGGACTGGAGGTAGG + Intergenic
1075403384 10:122177294-122177316 TTGGAAGGAGCAGTGGAGGGAGG + Intronic
1075463851 10:122636877-122636899 TCTGATGGAGAATTGGAGGCAGG - Intronic
1076735722 10:132458082-132458104 GTGGCAGGAGCATAGAAGGCTGG + Intergenic
1076823761 10:132957051-132957073 GCTGAAGAAGCATTGGCAGCAGG + Intergenic
1077348868 11:2080762-2080784 GTTGAAGGATCACTTGAGCCTGG - Intergenic
1078030673 11:7748095-7748117 GTGGAAGAAGCACTGGAGGCAGG - Intergenic
1078046269 11:7916608-7916630 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1078088253 11:8247603-8247625 ATTGTGGGAGGATTGGAGGCTGG - Intronic
1079161038 11:17994701-17994723 GGAGAAGGAGCATTGGATGTGGG - Intronic
1080028053 11:27633523-27633545 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1081167277 11:39821647-39821669 GTGGAGGGAACATTGAAGGCAGG - Intergenic
1081333040 11:41827548-41827570 GTTAAAAGTGCATTGGAGTCAGG + Intergenic
1081848155 11:46255715-46255737 GTTGAAGAAAAATTAGAGGCCGG + Intergenic
1082171306 11:49008670-49008692 GTTGCAGCAGCATAGGAGACAGG - Intergenic
1082267450 11:50134837-50134859 GTTGACGGATCACTGGAGGCTGG + Intergenic
1082288637 11:50343729-50343751 GTTGATGGATCACTGGAGGCTGG - Intergenic
1084393780 11:68895761-68895783 GTAGAAGGATCATTTGAGCCTGG - Intronic
1085595676 11:77807240-77807262 GTTGGAAAAGCATTCGAGGCAGG - Intronic
1087314535 11:96589191-96589213 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1089171347 11:116513767-116513789 TTTAAAGGAGCAGTGGAGGAAGG - Intergenic
1089401803 11:118168663-118168685 GTTGAAGGTGCAGGGCAGGCGGG + Exonic
1089561060 11:119343421-119343443 GTGGAAGGAGCACTTGAAGCTGG + Intronic
1089867899 11:121648082-121648104 GTGGGAGGATCATTTGAGGCTGG - Intergenic
1090203694 11:124873427-124873449 GTTGAAGCAGGTTTGGAGGAAGG - Intronic
1091294029 11:134459917-134459939 ATGGGAGGAGCCTTGGAGGCTGG + Intergenic
1092269396 12:7011126-7011148 GTGGAAGGATCACTGGAGCCCGG - Intronic
1092626890 12:10337375-10337397 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1092723858 12:11466617-11466639 GTAGAAGGAGGAATGGAGGGTGG + Intronic
1092926272 12:13275348-13275370 GTTCAAGGACTATTGGAGGAGGG - Intergenic
1093173446 12:15884233-15884255 CATGAAGGAACATTGGAGTCAGG - Intronic
1094007599 12:25771970-25771992 ATTGAAGGAGAATTCAAGGCAGG - Intergenic
1095964040 12:47854894-47854916 TTTAAAGAAGCAATGGAGGCTGG + Intronic
1096230091 12:49891986-49892008 GTTGAAGGCCCATTGGGGGTTGG - Intronic
1096388313 12:51210049-51210071 GTGGAAGGATCACTTGAGGCTGG - Intronic
1098173780 12:67771079-67771101 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1098628922 12:72704615-72704637 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1099188567 12:79541136-79541158 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1099594450 12:84642060-84642082 GCTGAAGAAGCATTGGCAGCAGG + Intergenic
1099762449 12:86940063-86940085 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1099809757 12:87566157-87566179 GTTGAAGGATCATTTGAGCCTGG - Intergenic
1100341121 12:93680028-93680050 TTTGAAGGAGAATTGGAAGCTGG + Intronic
1100561199 12:95750354-95750376 GTAGAAGGAGGAATGGAGGGTGG - Intronic
1100961398 12:99966657-99966679 GGTGATGGTGCTTTGGAGGCTGG - Intronic
1101278537 12:103227126-103227148 GTAGAAGGAGGAATGGAGGTTGG + Intergenic
1102173859 12:110861865-110861887 GCAGAAGTAGCATTTGAGGCCGG - Intronic
1103008018 12:117437195-117437217 GTGGGAGGATCACTGGAGGCTGG + Intronic
1104312239 12:127663827-127663849 ATGGCAGGACCATTGGAGGCAGG - Intergenic
1105946815 13:25197408-25197430 CCTGAAGAAGCAGTGGAGGCAGG - Intergenic
1107075437 13:36317709-36317731 GTAGAAGGAGGAATGGAGGGTGG - Intronic
1108913557 13:55582692-55582714 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1108919690 13:55659421-55659443 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1108947292 13:56041580-56041602 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1108953091 13:56116865-56116887 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1109716892 13:66230821-66230843 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1110264088 13:73518734-73518756 GTTGAAGGAAGAAAGGAGGCAGG + Intergenic
1111301905 13:86359673-86359695 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1111362861 13:87198273-87198295 ATTTAAGGAGCATTAGAGGAAGG + Intergenic
1111631845 13:90853014-90853036 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1115904665 14:38192056-38192078 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1116179535 14:41517222-41517244 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1116884090 14:50202054-50202076 GTGGGAGGATCATTGGAGTCTGG - Intronic
1117020141 14:51562072-51562094 GTTGAAGGAGCAATTGATGCCGG - Intronic
1118836269 14:69480211-69480233 GTGGAAGGAGGCTTGGAGGAGGG + Intergenic
1121550487 14:94795981-94796003 GGAGAAGGAGGGTTGGAGGCAGG + Intergenic
1122040851 14:98986469-98986491 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1124141427 15:27080548-27080570 GTGGAAGGATCACTTGAGGCTGG + Intronic
1125258169 15:37790929-37790951 GTTGAAAGAACAATGGAGGGTGG + Intergenic
1126227054 15:46282872-46282894 GGGGAAGGAGGAATGGAGGCAGG + Intergenic
1126845599 15:52757970-52757992 CTTTAAGCACCATTGGAGGCTGG + Intronic
1127438034 15:58977592-58977614 GTGGGAGGAGCATTTGAGCCTGG - Intronic
1128173820 15:65536108-65536130 GTGGAAGGATCACTTGAGGCTGG - Intronic
1128177673 15:65570540-65570562 GTTGAAGGAGCAATCCAGGTTGG + Intronic
1128738830 15:70069671-70069693 GAGGAAGGAGCCTTGGAGGTTGG - Intronic
1129046012 15:72734812-72734834 GTGGAAGGTGGAATGGAGGCAGG + Intronic
1129679862 15:77652692-77652714 GGTGAAGGAGGAATGGAAGCTGG - Intronic
1129759379 15:78120681-78120703 AGGGAAGGAGAATTGGAGGCGGG + Intronic
1130452225 15:84067254-84067276 GATGAAGGTGCATAGGAGACTGG - Intergenic
1130854972 15:87832538-87832560 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1130947621 15:88560921-88560943 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1131003618 15:88957995-88958017 GTGGGAGGATCATTGGAGCCTGG - Intergenic
1131325966 15:91445545-91445567 GTTAAAGGAGCATTTGAAGAAGG + Intergenic
1133272967 16:4619749-4619771 GTGGAAGGATCCTTTGAGGCTGG - Intronic
1133651253 16:7815968-7815990 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1133789888 16:9001504-9001526 GTGGAAGGATCATTTGAGCCTGG - Intergenic
1134361303 16:13533488-13533510 ATTGGAGAAGCATTGGAGGTTGG - Intergenic
1136127765 16:28196957-28196979 GCTGAAGGAGTATTTGAAGCTGG - Intronic
1136130830 16:28220002-28220024 GTGGAAGGATCACTGGAGCCTGG - Intergenic
1136354415 16:29734595-29734617 GTGGAAGGAACACTTGAGGCTGG - Intergenic
1136406522 16:30051165-30051187 GTGGGAGGATCATTTGAGGCAGG + Intronic
1136641130 16:31566190-31566212 CCTGAAGGATCATTGCAGGCAGG + Intergenic
1136663841 16:31791130-31791152 CCTGAAGGATCATTGCAGGCAGG - Intronic
1137668176 16:50263769-50263791 GGGGAAGGGGCATAGGAGGCAGG - Intronic
1138569560 16:57860804-57860826 GTGGAAGGATCAATGGAGCCTGG - Intronic
1138733182 16:59219000-59219022 GTTGAAGAAGCATTGGTGAGTGG - Intergenic
1138804798 16:60080099-60080121 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1138849579 16:60610747-60610769 GTGGAAGGATCTTTGGAGCCAGG + Intergenic
1140578345 16:76199211-76199233 GTGGAAGGATCATTTGAGCCTGG + Intergenic
1142679905 17:1540990-1541012 GCTGGAGGATCATTTGAGGCTGG - Intronic
1142864042 17:2779683-2779705 CTTGAAGGAGGAGTGGAGGGAGG + Intronic
1145895280 17:28453838-28453860 GTGGAAGGATCACTTGAGGCCGG + Intergenic
1146037212 17:29417979-29418001 GTAGAAGGATCACTGGAGCCTGG - Intronic
1146597750 17:34184541-34184563 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1147654727 17:42082396-42082418 GTTGTGGGAGCAGGGGAGGCTGG - Intergenic
1148680481 17:49470636-49470658 GTGGGAAGAGCATTGGGGGCAGG + Intronic
1148711837 17:49687568-49687590 GTGGAAGGATCATTTGAGACTGG + Intergenic
1149932432 17:60769526-60769548 GTTCAAAGACCTTTGGAGGCTGG + Intronic
1150117182 17:62563348-62563370 GTGGGAGGATCATTGGAGCCAGG + Intronic
1150381492 17:64723779-64723801 GTAGTAGGATCACTGGAGGCCGG + Intergenic
1150455231 17:65301928-65301950 GTGGAAGGAGCAGAGGATGCCGG + Intergenic
1151157646 17:72137572-72137594 GTGGAAGGAGCATCGGATACAGG + Intergenic
1151209628 17:72534738-72534760 GTTCAAAGAGCATTGCAGGGTGG - Intergenic
1151622337 17:75253823-75253845 GGAGAAGGAGGAATGGAGGCTGG - Intronic
1151811148 17:76442820-76442842 GTTGAAGGAGGACTAGAGGCAGG + Intronic
1152286653 17:79416635-79416657 GCTGCAGGAGAAGTGGAGGCCGG + Intronic
1153266065 18:3270759-3270781 GTGGAAGGATCATTTGAGCCTGG - Intronic
1153665018 18:7360665-7360687 GTGGAGGGAGAATTGGGGGCGGG + Intergenic
1153719354 18:7885807-7885829 GTGGATTTAGCATTGGAGGCAGG + Intronic
1154485402 18:14868090-14868112 GTGGTAGGAGCCTTGGAGGGTGG + Intergenic
1155406885 18:25498523-25498545 GTTGAAGGATCACTTGAGCCTGG + Intergenic
1156953294 18:42931248-42931270 GGGGAATGAGGATTGGAGGCTGG + Intronic
1157493787 18:48141202-48141224 GTTGGGGGAGCATTTCAGGCTGG - Intronic
1158248055 18:55453954-55453976 GTGGAAGGACTACTGGAGGCTGG - Intronic
1158906573 18:62018918-62018940 TTAGAAAAAGCATTGGAGGCTGG + Intergenic
1159598867 18:70409852-70409874 GATGAGGCAGGATTGGAGGCAGG - Intergenic
1160064511 18:75562293-75562315 GTGGAGTGAGCAGTGGAGGCTGG + Intergenic
1160886737 19:1353434-1353456 GTGGAAGGATCATTTGAGCCTGG + Intergenic
1160964048 19:1737989-1738011 GTGGGAGGATCATTTGAGGCCGG + Intergenic
1161906592 19:7161476-7161498 GTGGGAGGATCACTGGAGGCCGG - Intronic
1162529887 19:11229640-11229662 GTAGACGGGGCAGTGGAGGCAGG + Intronic
1162757417 19:12868556-12868578 GTGGAAAGAGCATTCCAGGCAGG + Intronic
1162938295 19:13993044-13993066 GTGGGAGGATCATTTGAGGCCGG + Intronic
1163492462 19:17624882-17624904 GCTGAAGGAGCTGTGGAAGCTGG - Exonic
1163619357 19:18348989-18349011 GTGGAAGGATCATTTGAGCCCGG - Intronic
1163846022 19:19638416-19638438 GTTCAAGGAGCAGTGGATGAAGG - Exonic
1164407467 19:27964793-27964815 GTTGAAGGAGAGGTGGAGGTAGG - Intergenic
1165067959 19:33240065-33240087 GAGGGAGGAGCAGTGGAGGCGGG + Intergenic
1165643125 19:37407265-37407287 GTGGAAGGATCAGTAGAGGCTGG - Intergenic
1167305820 19:48708724-48708746 GCGGAAGGTGCAATGGAGGCAGG + Intergenic
1167621702 19:50564374-50564396 GGGGAAGGAGCAGGGGAGGCGGG + Intronic
1168115629 19:54220206-54220228 CTGGAAGGAGCACGGGAGGCGGG + Intronic
1168118616 19:54239952-54239974 CTGGAAGGAGCACGGGAGGCGGG + Intronic
925184238 2:1836279-1836301 GCTGATGGAGTATTGGGGGCAGG - Intronic
925544407 2:5002247-5002269 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
925611364 2:5705743-5705765 GATGGAGGAGCAAGGGAGGCAGG + Intergenic
926413455 2:12627784-12627806 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
926674106 2:15605196-15605218 GTTGAAGACACATTGGAGGGTGG + Intronic
926725158 2:15991968-15991990 GGCGAAGGAGCATCGGAGTCAGG - Intergenic
927661054 2:24993143-24993165 GTGGAAGGATCATTTGAGCCTGG + Intergenic
928078681 2:28288715-28288737 GTTGAATCAGAATTGGAGACAGG - Intronic
928299215 2:30110846-30110868 GTAGGAGGATCATTGGAGGCCGG - Intergenic
928549892 2:32359795-32359817 GTGGGAGGATCATTTGAGGCCGG - Intronic
929529875 2:42742973-42742995 TTTTGAGGAGCATTGAAGGCAGG + Intronic
930182036 2:48369904-48369926 GTTGAAGGATCGTTTGAGCCTGG + Intronic
932261276 2:70329876-70329898 GTGGAAGGATCATTTGAGGCCGG - Intergenic
932974093 2:76578295-76578317 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
933012949 2:77089644-77089666 GTAGAAGGAGGAATGGAGGGTGG - Intronic
933082016 2:78002346-78002368 ATTGAAAGAAGATTGGAGGCAGG + Intergenic
934027281 2:88011816-88011838 GTGGAAGGATCAGTGGAGCCCGG - Intergenic
934118050 2:88814189-88814211 GTGGAAGGAGCCATGGGGGCAGG - Intergenic
934881462 2:97984407-97984429 TTTAAAGGAGTACTGGAGGCTGG + Intronic
936161584 2:110087454-110087476 GTGGAAGGAGCCATGGGGGCAGG - Intronic
936183079 2:110283900-110283922 GTGGAAGGAGCCATGGGGGCAGG + Intergenic
937197705 2:120174369-120174391 GTGGAAGGATCATTTGAGCCTGG + Intronic
938316644 2:130333985-130334007 GTGGAAGGAGCTTTGGAATCAGG + Intergenic
939105537 2:137944525-137944547 CTTGGAGGATCATTGGAGACAGG + Intergenic
939458743 2:142470809-142470831 GTTGTAGGAGCAGTGCAGCCTGG + Intergenic
939486963 2:142826797-142826819 GTTTAAAGAACATTCGAGGCCGG + Intergenic
942043978 2:172088350-172088372 GAAGAAGGAACAGTGGAGGCGGG + Exonic
942297494 2:174531975-174531997 GTAGAAGTAGCAGTGGAGGAAGG - Intergenic
942503430 2:176616585-176616607 GTAGAAGGAGAAGTGGAAGCAGG + Intergenic
943413073 2:187564921-187564943 GTAGAAGGAGGAATGGAGGGTGG + Intronic
944081957 2:195797903-195797925 GTTGAAGAAGCATTGGAATGTGG - Intronic
944393988 2:199248193-199248215 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
944763611 2:202841783-202841805 GTTGATGCAGGAGTGGAGGCAGG + Intronic
944971735 2:205001283-205001305 ACTGAAAGAGCATTGCAGGCTGG - Intronic
945153248 2:206811284-206811306 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
945160638 2:206886664-206886686 CTTGATGGAGCATTGGAGTCAGG - Intergenic
945938167 2:215923639-215923661 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
946387778 2:219395708-219395730 TGTGAAGGAGCTTGGGAGGCAGG - Intronic
947478004 2:230468722-230468744 GTGGAAGGATCATTTGAGCCTGG + Intronic
947581165 2:231319534-231319556 GTTTAAGGAGCATGGGCGCCTGG - Intronic
948863116 2:240762539-240762561 GTGGAAGCAGCATTGGGGGAGGG - Intronic
1170069004 20:12344706-12344728 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1170106093 20:12755152-12755174 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1172243556 20:33429854-33429876 GCTGAAGGATCATTTGAGCCTGG - Intronic
1173672446 20:44808415-44808437 TTTGTAGGAGCATCAGAGGCAGG - Intronic
1173760882 20:45559481-45559503 GTGGAAGAAGCATTGTAGTCAGG + Intronic
1175415553 20:58798455-58798477 GTTCAAGAAACATTGGAGGGAGG + Intergenic
1175431465 20:58907339-58907361 GTTGAAGAAGGAGTGGGGGCTGG - Intronic
1176152161 20:63597252-63597274 GTGGAAGGATCACTGGAGCCTGG - Intronic
1176795933 21:13371386-13371408 GTGGTAGGAGCCTTGGAGGGTGG - Intergenic
1178510513 21:33201590-33201612 GTGGAAGGATCATTTGAGCCCGG - Intergenic
1178522466 21:33297925-33297947 TTTGAAGGAACTGTGGAGGCTGG + Intergenic
1179387412 21:40956217-40956239 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1179603056 21:42493842-42493864 GTGGAAGGATCACTGGAGCCTGG - Intronic
1180110949 21:45650242-45650264 GTTGAAGGATCACTTAAGGCTGG + Intronic
1180785806 22:18547093-18547115 GTTGCACGGTCATTGGAGGCCGG - Intergenic
1181131087 22:20732818-20732840 GTTGCACGGTCATTGGAGGCCGG - Intronic
1181168967 22:20997731-20997753 GTTGGAGGAGCCTTGGTGACAGG - Exonic
1181242731 22:21486647-21486669 GTTGCACGGTCATTGGAGGCCGG - Intergenic
1182489080 22:30658011-30658033 GTAAGAGGATCATTGGAGGCTGG + Intronic
1183387494 22:37523475-37523497 GTTGAAGGAGGATTGGAAGGGGG + Intergenic
1183518851 22:38284557-38284579 GTAGAAGGATCACTGGAGCCTGG + Intergenic
1183917765 22:41136565-41136587 GTGGGAGGAGCACTTGAGGCTGG + Intronic
1184343937 22:43901538-43901560 GAGGAAGGAGCATTGGCGGGAGG - Intergenic
1184537956 22:45100245-45100267 GATGAAGGAGCAGAGGTGGCCGG + Intergenic
1185316041 22:50179534-50179556 GATGCAGGAGCATGGGAAGCGGG - Exonic
1185355450 22:50366820-50366842 GAAGAAGAAGCAGTGGAGGCTGG - Intronic
949863999 3:8532465-8532487 TTTGAAACAGCACTGGAGGCTGG + Intronic
950723234 3:14899306-14899328 GTTTATGGAGCAGTGGAGGATGG - Intronic
951077390 3:18412310-18412332 GTCCTAAGAGCATTGGAGGCAGG + Intronic
951445271 3:22772389-22772411 GTTGAAGAAGCATTTAAGGATGG + Intergenic
951863268 3:27277523-27277545 GATGAAGGAGCCTTGGTGGGTGG - Intronic
952250971 3:31653684-31653706 GTAGGAGGAGCACTTGAGGCTGG + Intergenic
954277230 3:49550475-49550497 GTTCAAGGAGCCTTGTAGGCAGG + Intergenic
956931280 3:74046206-74046228 GTTGAAAAAGAATTGCAGGCAGG + Intergenic
958897050 3:99840844-99840866 GGGGAAGGAGCACTGGAGGCAGG - Intronic
958909642 3:99979470-99979492 GATGAACCAGCATTGGAGTCAGG + Intronic
959288490 3:104444359-104444381 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
959490612 3:106984397-106984419 GTTGAATGTGCATTAGAGTCTGG + Intergenic
959972406 3:112422005-112422027 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
960283025 3:115797932-115797954 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
961448207 3:126990980-126991002 GAGGAAGGAGCAGGGGAGGCTGG - Intronic
962712975 3:138102919-138102941 GTGGAAGCAGGAGTGGAGGCAGG + Intronic
963684186 3:148415614-148415636 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
964116862 3:153145427-153145449 GTAGAATGAGGATTGGGGGCAGG - Intergenic
964691061 3:159450595-159450617 TTTGAAGAAGCTTTGGGGGCAGG - Intronic
965713255 3:171577685-171577707 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
966378654 3:179322751-179322773 CTTGAAGGGGCGGTGGAGGCGGG + Intergenic
966723868 3:183091046-183091068 GTAGAGGGAGAATTGGAGGTTGG + Intronic
967212312 3:187179956-187179978 GTAGAAGGAGGAATGGAGGGTGG + Intronic
967624792 3:191670930-191670952 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
970960140 4:21861964-21861986 GTTTAAGGAGGCTTGGAGGAGGG - Intronic
973335617 4:48952998-48953020 GTGGAAGGATCATTTGAGCCTGG + Intergenic
973572653 4:52256283-52256305 GTGGACGGAGCATTGGTGGAAGG + Intergenic
973737259 4:53884900-53884922 GTGGAAGGATCATTTGAGGCTGG + Intronic
974003519 4:56533717-56533739 GTGGAAGGATCACTTGAGGCTGG + Intronic
974355218 4:60803937-60803959 GTAGGAGGAGCAGTGGAGGAAGG - Intergenic
975481704 4:74888028-74888050 GTTGGAGGATCATTTGAGCCTGG + Intergenic
975865235 4:78718305-78718327 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
976645382 4:87381938-87381960 GATGAAGGCGCATGGGAGGCAGG + Intronic
976663538 4:87565571-87565593 GTTGAACCAGCAATGGAAGCAGG + Intergenic
976696390 4:87923132-87923154 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
976773422 4:88680105-88680127 GGTGAAGAAGCAGTGGATGCCGG + Exonic
976873261 4:89822334-89822356 GTTGGAGGAGCAGTGGTGACGGG - Exonic
977013074 4:91659070-91659092 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
977062656 4:92275939-92275961 GTAGAAGGAGGAATGGAGGGCGG + Intergenic
977075357 4:92443407-92443429 GTAGAAGGAGGAATGGAGGGTGG + Intronic
977177652 4:93835899-93835921 GGTGAAGTAGCATTTGAGGGAGG + Intergenic
978516967 4:109579002-109579024 TGTGAAGGAATATTGGAGGCGGG - Intronic
979850452 4:125566083-125566105 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
980749583 4:137070869-137070891 TTAGAAGGAGCAGTGGAGGCTGG + Intergenic
981539579 4:145834006-145834028 GTAGAAGGAGGAATGGAGGGTGG - Intronic
981568356 4:146125066-146125088 GTAGAAGGATCATTTGAGCCTGG + Intergenic
982535300 4:156601561-156601583 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
982799470 4:159686040-159686062 GTTGGATAAGCATTTGAGGCGGG - Intergenic
983360273 4:166717563-166717585 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
983539675 4:168895910-168895932 GTTGAAAGTGCATTTAAGGCGGG + Intronic
984011481 4:174376718-174376740 CTTTAAGGAGCAGGGGAGGCTGG + Intergenic
984894579 4:184526560-184526582 GATCATGGAGAATTGGAGGCAGG + Intergenic
984947675 4:184982682-184982704 GTTCAATCAGCATTGGAAGCAGG + Intergenic
985390022 4:189483910-189483932 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
985533099 5:445192-445214 GTGGAGGGAGCATGGAAGGCAGG + Intronic
986124637 5:4874003-4874025 GCTGAAGGATCACTTGAGGCCGG - Intergenic
986388735 5:7264864-7264886 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
988482831 5:31643910-31643932 GTGGAAGGATCACTGGAGCCGGG - Intronic
988594660 5:32580757-32580779 GTTGAAGGAGAAGGGGAAGCAGG + Intronic
989070896 5:37510252-37510274 GTTGAGGGAGGAATGGAGGAGGG - Intronic
990477041 5:56171530-56171552 GTTAAAGTAGCATGGGAGGGAGG - Intronic
990988721 5:61664422-61664444 GTGGAAGGAGCCTTGGAAGTGGG + Intronic
992394518 5:76358618-76358640 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
993626071 5:90226267-90226289 TTTGAAGGAGAAAAGGAGGCAGG - Intergenic
993846904 5:92955270-92955292 TTTGAAGGAGCATTTCAGGTTGG + Intergenic
994320967 5:98393531-98393553 GTGGAAGCAGGAGTGGAGGCAGG + Intergenic
994779155 5:104068982-104069004 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
995000429 5:107121063-107121085 GTGGAAGGATCATTTGAGCCTGG + Intergenic
995243920 5:109916066-109916088 GTTTCAAGAGCATTGGAGGCCGG - Intergenic
995578373 5:113567160-113567182 GTTAAAGCTGCATTGGTGGCAGG + Exonic
995804817 5:116039253-116039275 GTTGAAGGATGATAGGAGGAGGG - Intronic
996287841 5:121815698-121815720 ACTGGAGGAGCATTGGAGGTTGG - Intergenic
996374991 5:122794927-122794949 GTGGAAGGATCATTTGAGCCTGG + Intronic
996633337 5:125663535-125663557 GTTGAAGGAGAGTTGAATGCAGG + Intergenic
996745593 5:126844007-126844029 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
997769820 5:136544061-136544083 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
997772785 5:136569781-136569803 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
997825904 5:137106690-137106712 GTTGGGGCAGGATTGGAGGCAGG - Intronic
998374199 5:141680588-141680610 TTTGGAGGAAGATTGGAGGCTGG - Intronic
1000088713 5:157911466-157911488 TTAGAAGGAGCAGTGGTGGCCGG + Intergenic
1000259610 5:159574996-159575018 GTGGAAGCAGCAATGGAGACTGG - Intergenic
1001088541 5:168720005-168720027 GTGGGAGGATCATTGGAGCCTGG - Intronic
1001436352 5:171702592-171702614 GTGTAAGGAGCCTTGGAGCCAGG + Intergenic
1001980476 5:176034518-176034540 GTGGAAGGAGCCCTGGAGGGTGG - Intronic
1002107639 5:176887992-176888014 GTGGGAGGATCATTGGAGCCTGG - Intronic
1002236985 5:177809547-177809569 GTGGAAGGAGCCCTGGAGGGTGG + Intergenic
1002724178 5:181283529-181283551 GTAGTAGGAGCCTTGGAGGGTGG + Intergenic
1003273368 6:4626501-4626523 GTGGGAGGATCACTGGAGGCTGG - Intergenic
1003294589 6:4813865-4813887 GTGGAAGGATCGTTGGAGCCTGG - Intronic
1004283671 6:14301398-14301420 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1004567371 6:16811180-16811202 GGTGAAGTAGCATTTGAGCCAGG - Intergenic
1007563705 6:42831830-42831852 GTGGAAGGATCACTTGAGGCTGG - Intronic
1008542181 6:52554860-52554882 GTAGGAGGATCATTTGAGGCTGG - Intronic
1010586842 6:77664982-77665004 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1011334855 6:86249179-86249201 GTGGAAGGATCACTTGAGGCTGG - Intergenic
1011342084 6:86327421-86327443 GTGGGAGGATCATTGGAGCCCGG - Intergenic
1013843829 6:114426771-114426793 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1014315018 6:119852916-119852938 GTGGAAGGAGCATTAGAAGGGGG - Intergenic
1014360302 6:120466700-120466722 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1014455013 6:121624871-121624893 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1015269522 6:131324702-131324724 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1015288181 6:131508728-131508750 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1015310095 6:131757287-131757309 GTTCAAGGAGCAGTAGAAGCCGG + Intergenic
1016248713 6:142017077-142017099 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1017196598 6:151707061-151707083 GTTGAAGGAGCATTGGAGGCAGG + Intronic
1017998879 6:159560669-159560691 GTTAAAAGAGCACTGTAGGCCGG - Intergenic
1019366443 7:635771-635793 GGTGAATGAGCTTTGGAGGCAGG + Intronic
1019371214 7:662828-662850 GTGGGGGGAGCTTTGGAGGCTGG - Intronic
1020532856 7:9357851-9357873 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1021129212 7:16890831-16890853 ATAGAAGGACCACTGGAGGCTGG - Intergenic
1021506897 7:21395972-21395994 GTGGAAGGATCATTTGAGCCTGG + Intergenic
1021810515 7:24397539-24397561 GTCGAAGGAGGAATGGAGGGTGG - Intergenic
1023132515 7:37016932-37016954 GGTGGAGGTGCATTGGAGGCAGG - Intronic
1023699037 7:42875055-42875077 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1023785270 7:43701263-43701285 GTTGATGGAGGATTTGAGGATGG - Intronic
1024934099 7:54695234-54695256 GTGGGAGGATCATTTGAGGCCGG + Intergenic
1026377061 7:69762398-69762420 GTGGAAGGATCACTGGAGCCAGG - Intronic
1026545368 7:71317487-71317509 GTGGAAGGATCGTTTGAGGCTGG + Intronic
1027143707 7:75679295-75679317 GTGGAAGGATCACTGGAGCCAGG - Intronic
1027851800 7:83460931-83460953 GTAGAAGGAGGAATGGAGGGTGG - Intronic
1029519281 7:101049900-101049922 GTGGAAGGATTATTTGAGGCCGG + Intronic
1029655959 7:101924657-101924679 GTGGGAGGATCATTTGAGGCTGG - Intronic
1029960621 7:104686277-104686299 GGTGTAGGTGCCTTGGAGGCAGG - Intronic
1030951280 7:115793110-115793132 CTTGCAGGAGCATTGCAGGCAGG + Intergenic
1031030586 7:116730198-116730220 GTGGAAGGAGCATTTCAAGCCGG + Intronic
1031525447 7:122818183-122818205 GTAGAAGGAGGAATGGAGGGTGG - Intronic
1031728075 7:125263350-125263372 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1031776182 7:125911251-125911273 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1032376313 7:131422317-131422339 GTGGAAGGATCACTTGAGGCTGG + Intronic
1033056005 7:138055033-138055055 GTTGAAGGAGCAAGGCAGCCTGG + Intronic
1034507041 7:151500888-151500910 GTGGAAGGATCATTTGAGCCTGG + Intronic
1034563036 7:151893917-151893939 GTTGGAGGAGGATGTGAGGCAGG - Intergenic
1034962019 7:155368620-155368642 GTGGGAGGATCACTGGAGGCAGG + Intergenic
1035760502 8:2065238-2065260 TTGGAAGGAGAATTTGAGGCTGG + Intronic
1037095691 8:14983571-14983593 GTAGGAGGAGCGTTTGAGGCTGG - Intronic
1037817732 8:22120721-22120743 CTTCCAGGAGCACTGGAGGCAGG - Exonic
1039505870 8:38051952-38051974 GTTGGAGGATCACTTGAGGCTGG - Intronic
1041207815 8:55515964-55515986 GTGGATGGAGCTTTGGAAGCAGG + Intronic
1042707215 8:71676175-71676197 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1042897286 8:73685138-73685160 GTTAAAGGTGAATGGGAGGCAGG - Intronic
1043514218 8:80981259-80981281 GTTGAAGGAGCATTGGAACTGGG - Intronic
1043783898 8:84372507-84372529 GTTGGAGGATCACTTGAGGCTGG + Intronic
1044598019 8:93977358-93977380 GTGGAAGGATCATTTGAGCCTGG + Intergenic
1046439917 8:114242904-114242926 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1046443106 8:114283255-114283277 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1046732226 8:117738049-117738071 GTTGAAGCAGTTTTGGAGGGAGG - Intergenic
1047317250 8:123745901-123745923 GTTGAAAGAGAATAGAAGGCTGG + Intergenic
1047699209 8:127433005-127433027 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1048909944 8:139125673-139125695 GTGGAAGAAGCATTGCATGCAGG + Intergenic
1049018655 8:139939280-139939302 GGTCAAGGAGCATAGGAGCCAGG + Intronic
1049054701 8:140226656-140226678 GTGGAAGGAGGGTTGCAGGCAGG - Intronic
1049280185 8:141740196-141740218 GTTCTAGGAGCATTGGAGTCTGG + Intergenic
1049362694 8:142219806-142219828 GGTGAAGGAGGCTGGGAGGCCGG - Intronic
1050259311 9:3824444-3824466 GCTGAAGGAGGATTTTAGGCAGG + Intronic
1050577093 9:7008385-7008407 GTTGAGGCAGACTTGGAGGCTGG - Intronic
1051076139 9:13238618-13238640 GTTGAAGTAGCATTGTTGTCTGG - Intronic
1051150429 9:14073355-14073377 GATGAAGGTGCACTGGAGGAAGG + Intergenic
1051525685 9:18041091-18041113 GCTGAAGGAGCATCAGAAGCTGG + Intergenic
1051629929 9:19131562-19131584 GTGGAAGGATCATTTGAGCCTGG + Intronic
1053886320 9:42646962-42646984 GTGGTAGGAGCCTTGGAGGGTGG + Intergenic
1054225340 9:62454411-62454433 GTGGTAGGAGCCTTGGAGGGTGG + Intergenic
1055232915 9:74086930-74086952 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1055809906 9:80138683-80138705 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1056061018 9:82885046-82885068 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1056323738 9:85459909-85459931 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1056949045 9:91027308-91027330 GTTCAAGGAGCATAGGGGCCAGG - Intergenic
1058380865 9:104375723-104375745 GTGGAAGGATCACTGGAGGTCGG + Intergenic
1058531252 9:105906848-105906870 GTTGAATTAGTATTGGAGGTGGG - Intergenic
1058568480 9:106313120-106313142 GTTTAAGGAGCATCTCAGGCAGG - Intergenic
1058696899 9:107566326-107566348 GTTTAAGAAGCACTGGGGGCCGG - Intergenic
1059926632 9:119216254-119216276 GTTGAACCAGCATTGGTGACAGG + Intronic
1060187206 9:121570955-121570977 CATGAAGGAGCAGAGGAGGCAGG - Intronic
1060590805 9:124815499-124815521 GCTGAATGGGAATTGGAGGCCGG + Intergenic
1061073101 9:128323849-128323871 GTGGAAGGACCATTTGAGCCGGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061750729 9:132775175-132775197 GTTGAACCAGCAATGCAGGCTGG + Intronic
1062271238 9:135710426-135710448 GTTGATGGAGAAATGGAGGCCGG - Intronic
1062344090 9:136106933-136106955 GCAGAAGCAGCACTGGAGGCTGG - Intergenic
1203547134 Un_KI270743v1:136803-136825 GTTGAAGCAGCTTTGGAACCAGG - Intergenic
1186078456 X:5905771-5905793 GTGGAAGGATCATTTGAGCCTGG - Intronic
1188369389 X:29350037-29350059 AATAAAGGAGCATTGGAAGCGGG - Intronic
1189248738 X:39583390-39583412 TTTGGTGGAGCTTTGGAGGCAGG + Intergenic
1190489579 X:50968286-50968308 GTGGGAGGAGATTTGGAGGCGGG - Intergenic
1190793893 X:53723800-53723822 GTAGAAGCAGCTTTGGAGTCAGG + Intergenic
1191220604 X:57984662-57984684 GTGGAAGCAGGAGTGGAGGCAGG - Intergenic
1194308680 X:92277477-92277499 GTAGAAGGAGGAATGGAGGGTGG + Intronic
1194429051 X:93777921-93777943 GTGGAAGGATCATTAGAGCCTGG + Intergenic
1194822908 X:98528703-98528725 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1195504792 X:105644755-105644777 GTTGGGGGGGCATGGGAGGCTGG - Intronic
1195533750 X:105986815-105986837 GTTGAAGGAGCACTTGAGCCTGG + Intergenic
1196072937 X:111545181-111545203 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1196165402 X:112531879-112531901 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1196330677 X:114468027-114468049 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1196341864 X:114605748-114605770 GTAGAAGGAGGAATGGAGGGTGG + Intronic
1196395143 X:115252611-115252633 GTGGAAGGATCATTTGAGCCTGG + Intergenic
1196424409 X:115555439-115555461 GTTGGAGGATCACTTGAGGCTGG - Intergenic
1197064767 X:122223302-122223324 GTAGAAGGAGGAATGGAGGGTGG - Intergenic
1197352205 X:125393297-125393319 GTAGAAGGAGGAATGGAGGGTGG + Intergenic
1198071865 X:133156748-133156770 GTGGAAGGATCATTTGAGCCTGG - Intergenic
1198073521 X:133172565-133172587 GTATAAGGAGCATTGGAATCAGG + Intergenic
1199708284 X:150450031-150450053 GTAGGAAGAGCTTTGGAGGCAGG - Intronic
1200886509 Y:8277588-8277610 GTTGCAGGATCAGTTGAGGCTGG - Intergenic
1200951927 Y:8905738-8905760 GTGGGAGGATCATTTGAGGCTGG + Intergenic
1201539634 Y:15091745-15091767 GTTGAAGAAGTTTTGCAGGCCGG - Intergenic