ID: 1017200469

View in Genome Browser
Species Human (GRCh38)
Location 6:151748416-151748438
Sequence AAGAGTAAAAAGAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1377
Summary {0: 1, 1: 1, 2: 16, 3: 114, 4: 1245}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017200469 Original CRISPR AAGAGTAAAAAGAATGAGGC AGG (reversed) Intronic
900200635 1:1404139-1404161 AAAAGTTAAAACAATGAGGCTGG - Intronic
900654891 1:3751760-3751782 AAAAGTACAAAAAATGAGCCGGG - Intergenic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
901046847 1:6401808-6401830 AAAAATATAAAGAAAGAGGCCGG - Intergenic
901218684 1:7569962-7569984 AAGAGTCCAAAGGATTAGGCAGG - Intronic
901560836 1:10068980-10069002 AAGAGTTAAGAGACAGAGGCAGG - Intronic
901592428 1:10356603-10356625 AAAAGAAAAAAAAATGCGGCCGG + Intronic
901622776 1:10602081-10602103 AAGAGGCAAAAGAATGGGGTGGG + Intronic
901835547 1:11921844-11921866 AAAAATAATAATAATGAGGCTGG - Intronic
902461462 1:16580496-16580518 AAGAATACAAAAAATTAGGCAGG - Intronic
902462247 1:16586795-16586817 AAGAATACAAAAAATTAGGCAGG - Intronic
903165597 1:21518204-21518226 AAGAGTGACGAGAAAGAGGCTGG + Intronic
903437879 1:23365755-23365777 AAAAATAAAAAGAATTAGCCGGG + Intronic
903559987 1:24220040-24220062 AAAAATAAAAAAGATGAGGCAGG + Intergenic
903594038 1:24480350-24480372 GAGACTAAAATGACTGAGGCCGG + Intergenic
903695136 1:25200877-25200899 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
903928083 1:26845627-26845649 ATTAAAAAAAAGAATGAGGCCGG - Intronic
904139640 1:28342462-28342484 AAGAAAAAAAATAAAGAGGCTGG - Intergenic
904157633 1:28497832-28497854 AAAAGTAAAAAAAATTAGCCGGG + Exonic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904257472 1:29264497-29264519 AAAAAAAAAAAGAATGAGGTTGG - Intronic
904645873 1:31965807-31965829 AAAAAAAAAAAAAATGAGGCTGG + Intergenic
904867696 1:33594492-33594514 AAGAGAAATAAAAAAGAGGCTGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904932628 1:34102189-34102211 AAAAGTAAAAAAAATTAGCCGGG - Intronic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905073475 1:35248378-35248400 AAAAAAAAAAAGAATGAAGCTGG - Intergenic
905095639 1:35467983-35468005 AATATTAAAAAGATTGTGGCTGG - Intronic
905158805 1:36013095-36013117 AAAATTAAAAAGAATTAGCCAGG - Intronic
905704358 1:40043077-40043099 AAGAGTAAAGATACGGAGGCAGG + Intronic
906502555 1:46352152-46352174 AAAAAAAAAAAGAATGTGGCTGG + Intronic
907112582 1:51939733-51939755 AAAAGTAAAAAAAATTAGCCAGG - Intronic
907692065 1:56678988-56679010 TAGACTAAAAAGAATTAGGCTGG - Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
907885216 1:58586589-58586611 AAGTCTAGGAAGAATGAGGCAGG + Intergenic
907886763 1:58599156-58599178 AAAAGAAAAAAGAATTAGCCAGG - Intergenic
909081541 1:71118384-71118406 AAGAGAAAAAAGAAAGAGAAGGG + Intergenic
909972740 1:82009730-82009752 AAGAGAAATAAAAATGAGGATGG - Intergenic
909984903 1:82149383-82149405 AAGAGTAAAGACAGTTAGGCTGG + Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910247782 1:85160658-85160680 AATAGCACAAAGAATGAGGGGGG - Intronic
910405448 1:86884637-86884659 AAAAGTAAAAATACTGAGGTTGG - Intronic
910648094 1:89535087-89535109 AAGGGGAAAAAGAATATGGCTGG + Intronic
910910399 1:92227977-92227999 AAGAGAAAAGAGAATGGAGCAGG - Intronic
910937753 1:92499512-92499534 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911032514 1:93505099-93505121 AAAAAAAAAAAGAATGAAGCTGG - Intronic
911333556 1:96553838-96553860 AAGAGTTAAATGAATGAGTGGGG + Intergenic
911505451 1:98744302-98744324 AAAAGTGAAAAGAATGAAGCAGG + Intronic
911720633 1:101187467-101187489 AAGAGTAAACAAAATGTGGAAGG + Intergenic
911757485 1:101575892-101575914 AAGAGTAAACAGCCGGAGGCAGG + Intergenic
912356259 1:109056402-109056424 AAGAAAAAAAAAAATTAGGCAGG + Intergenic
912368174 1:109151861-109151883 AAAAAAAAAAAGGATGAGGCTGG - Intronic
912883631 1:113445446-113445468 AATAATAAAAAAAATGAGTCAGG + Intronic
913237614 1:116798415-116798437 AAGGGTGAAAATTATGAGGCTGG + Intergenic
913571738 1:120127209-120127231 GCCAATAAAAAGAATGAGGCAGG + Intergenic
913603220 1:120441722-120441744 AAGAATACAAAAAATTAGGCAGG + Intergenic
913603967 1:120448074-120448096 AAGAATACAAAAAATTAGGCAGG + Intergenic
913640834 1:120810791-120810813 AAGAATACAAAAAATTAGGCAGG + Intronic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914277643 1:146139554-146139576 AAGAATACAAAAAATTAGGCAGG - Intronic
914292658 1:146288831-146288853 GCCAATAAAAAGAATGAGGCAGG + Intergenic
914487281 1:148121800-148121822 AAGAATACAAAAAATTAGGCAGG - Intronic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914538689 1:148590502-148590524 AAGAATACAAAAAATTAGGCAGG - Intronic
914553702 1:148739614-148739636 GCCAATAAAAAGAATGAGGCAGG + Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914782011 1:150793896-150793918 GAGAGAAGAAAGAAAGAGGCCGG - Intergenic
915017155 1:152744681-152744703 AAGAGAAGAAAGAATGAGAGGGG - Intronic
915047439 1:153030256-153030278 ATGAGTGAAAATAATGAGGGAGG + Intergenic
915105185 1:153530350-153530372 AAAATTAAAAAAAATTAGGCAGG + Intergenic
915575727 1:156775332-156775354 AAAAGAAAGAAAAATGAGGCAGG - Intronic
915587270 1:156850850-156850872 TAAAATAAAAAGAATGAGCCAGG - Intronic
915783038 1:158575239-158575261 AACAGGAAAAAGAAAGAGCCAGG - Intergenic
915940726 1:160116598-160116620 AAGATTAACAACAATGGGGCGGG + Intronic
916026845 1:160840556-160840578 AAAAGAAACAAGACTGAGGCAGG - Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916568485 1:166004276-166004298 AAAAAAAAAAAGAATGATGCTGG + Intergenic
916599735 1:166281121-166281143 AAAAGTACAAAAAATTAGGCAGG + Intergenic
916710324 1:167399832-167399854 AAGAGTACAAAAAATTAGCCGGG - Intronic
916807991 1:168278835-168278857 AACACTGAAAAGAATGTGGCAGG - Intergenic
916926053 1:169521775-169521797 AATATTAAAAAAAATTAGGCAGG - Intronic
917102760 1:171462034-171462056 AAGAGAGAAAAGAACTAGGCTGG + Intergenic
917600277 1:176566733-176566755 AAGTGCAAAAAGGAGGAGGCAGG - Intronic
917938475 1:179892942-179892964 TTTAGTAGAAAGAATGAGGCTGG + Intronic
918123604 1:181561434-181561456 AAGATTAACTAGAAAGAGGCTGG - Intronic
918382169 1:183967102-183967124 AAGAGAAACATGAATGAGCCTGG - Intronic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918830346 1:189387859-189387881 AAGAGTTCAAAGAGTAAGGCTGG - Intergenic
918830362 1:189387965-189387987 AAGAGTTCAAAGAGTAAGGCTGG - Intergenic
919014439 1:192013323-192013345 AAGAGTAAAAATAACTTGGCAGG + Intergenic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
920017299 1:202922897-202922919 AAGATCACAAAGACTGAGGCAGG - Intronic
920350340 1:205333934-205333956 AAGAGAAAAAAGAAAGAAGAGGG - Intergenic
920361920 1:205424587-205424609 AAGAGTGAAAAGAATGCTGCAGG + Intronic
921052011 1:211517535-211517557 GAGAGAAAGAAGAGTGAGGCTGG - Intergenic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
922282842 1:224142517-224142539 ATGAGAAAAAAAAATCAGGCTGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922486795 1:225979513-225979535 AAAAGTACAAAGAATTAGCCAGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922681138 1:227597083-227597105 ACCAGTAATCAGAATGAGGCAGG - Intronic
922925540 1:229343855-229343877 AAAAATAAAAAGAATTAGCCCGG + Intergenic
923004975 1:230041397-230041419 AAAAATACAAAAAATGAGGCAGG - Intergenic
923054420 1:230415105-230415127 AAAATTAAAAAGAATTAGGTGGG + Intronic
923059622 1:230458898-230458920 AGGAGAAAAAGGAGTGAGGCAGG - Intergenic
923300272 1:232633635-232633657 AACTGTAAAAAGAATTAGGCCGG - Intergenic
923455828 1:234164406-234164428 GAGAGGAAAAAGAAAGAGGGAGG - Intronic
923455944 1:234165679-234165701 AAAAGAAAAAAGAATGAGCCAGG - Intronic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924227079 1:241930888-241930910 AAAGGAAAAAGGAATGAGGCTGG + Intergenic
924245211 1:242077107-242077129 AAGAATAAAAAGAGTGACCCAGG + Intergenic
924335761 1:242985619-242985641 AAAAGAAAAAAGAATTAGCCAGG + Intergenic
924788981 1:247226415-247226437 AAGAAGAAAAAGAATGAGTGTGG - Intergenic
924826883 1:247549099-247549121 AAGAGGAAAATGCATGAGGCAGG - Intronic
1062860681 10:806948-806970 AACAGTTAGAAGACTGAGGCTGG + Exonic
1062954842 10:1533277-1533299 AAAAAAAAAAAGAATGAGCCAGG - Intronic
1063446113 10:6118462-6118484 AAGAAAAAAAAAAAGGAGGCCGG - Intergenic
1063483505 10:6397762-6397784 AAAAGTACAAAAAATTAGGCGGG + Intergenic
1063554542 10:7065818-7065840 AAAAGTACAAAAAATTAGGCGGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1065076500 10:22084764-22084786 AAAAGTACAAAGAATAAGACTGG - Intergenic
1065117957 10:22500184-22500206 AAAAATAAAAAAAATGAGCCAGG + Intergenic
1065305015 10:24360205-24360227 AAAAGTACAAAGAATTAGCCGGG - Intronic
1065466471 10:26029344-26029366 AAAAGTGAAAAGAATGAGAGAGG - Intronic
1065797419 10:29319940-29319962 AAGAATTAAAAGAATTAGCCAGG + Intergenic
1065865490 10:29911380-29911402 AAAAATAAAAAGAATTAGCCAGG + Intergenic
1065958637 10:30715285-30715307 AAGAAAAAAAGAAATGAGGCCGG + Intergenic
1066007595 10:31160227-31160249 GAGAAAAAAAAGAATGAAGCTGG - Intergenic
1066106820 10:32163997-32164019 AAAAGTACAAAGAATTAGCCGGG - Intergenic
1066303426 10:34117040-34117062 AAGAGGCAAAAGACAGAGGCAGG - Intronic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066546014 10:36501531-36501553 ATGAGGACAAAGAGTGAGGCTGG - Intergenic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1067015006 10:42752118-42752140 AAGACTAGAAAGCATGAAGCAGG - Intergenic
1067107404 10:43375321-43375343 AAGAAGAAAAAAAGTGAGGCTGG - Intronic
1067122896 10:43490051-43490073 AAAAGTAGAAGGATTGAGGCCGG + Intergenic
1067130730 10:43563016-43563038 AATAATATGAAGAATGAGGCCGG + Intronic
1067513880 10:46920325-46920347 AAGAAATCAAAGAATGAGGCAGG + Intronic
1067648374 10:48131509-48131531 AAGAAATCAAAGAATGAGGCAGG - Intergenic
1067666187 10:48281136-48281158 AAAAGTAACAAGGATGAAGCTGG - Intergenic
1068233510 10:54202319-54202341 AAGAGAAAAAAAAAAGAGGGAGG + Intronic
1068445801 10:57120867-57120889 AAGAATAAAAAGACTCAGGCTGG - Intergenic
1068558319 10:58482779-58482801 GGGAGCAAAAAAAATGAGGCAGG - Intergenic
1068756383 10:60658937-60658959 AAGAGAAAAAAGAGGCAGGCAGG + Intronic
1069095444 10:64253864-64253886 AAAAGAAAAAAGAGAGAGGCAGG - Intergenic
1069476664 10:68739443-68739465 CATAAAAAAAAGAATGAGGCTGG - Intronic
1069481560 10:68787316-68787338 AGCTATAAAAAGAATGAGGCAGG - Intronic
1069524692 10:69159076-69159098 AGGGTTAAAAAGATTGAGGCCGG + Intronic
1069567224 10:69471750-69471772 AAAAGTAAGAAGAATTAGCCAGG - Intronic
1069811725 10:71165450-71165472 AAAAATACAAAGAATTAGGCTGG + Intergenic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1069976831 10:72220490-72220512 AAAAGTAAAAAGAATTAGCTGGG + Intronic
1070084461 10:73222956-73222978 AAAAGTAAAAATAATTAGCCAGG + Intronic
1070466783 10:76732028-76732050 GAGAGGAAAAAGAAGGGGGCTGG - Intergenic
1071003592 10:80858381-80858403 AGGAGCAGAAAGAATGTGGCTGG - Intergenic
1071055182 10:81501913-81501935 AAGTGTAAAAAAAATGAAGTGGG - Intergenic
1071104226 10:82075990-82076012 ATGAGTAAAAAGACTGAGGGAGG + Intronic
1071502336 10:86212666-86212688 AAGAGTACAGATAATGAGGGTGG - Intronic
1071596269 10:86928949-86928971 AACATAAAAAAGAATAAGGCCGG - Exonic
1071833849 10:89399383-89399405 AACAGTAAAAATAATTAAGCTGG - Intronic
1072710516 10:97713375-97713397 AAGAGGGAAAAGGAGGAGGCAGG + Intronic
1072798616 10:98375742-98375764 ATGAGTGAAAAGAATAAGGTGGG - Intergenic
1073023042 10:100462823-100462845 AAGAGGACAAAGAAAGAAGCGGG - Intergenic
1073027384 10:100497913-100497935 TAGAGTAGAAAGAGAGAGGCAGG + Intronic
1073034904 10:100557162-100557184 AAGAGTAAAGGAAATGGGGCAGG + Exonic
1073343737 10:102766138-102766160 AAGATTAAAAAAAATTAGCCAGG + Intronic
1073367347 10:102954286-102954308 AAAAATACAAAGAATGAGCCAGG - Intronic
1073393121 10:103195329-103195351 AATAATAAAAAGAATGAGGCCGG + Intergenic
1073654363 10:105396754-105396776 AACAGTAGAAAGAATGAAACTGG - Intergenic
1073977317 10:109116327-109116349 AAAAATAAAAAGAATTAGCCAGG - Intergenic
1074343209 10:112654775-112654797 AAGTATAAAAAGAATGGGGCCGG - Intronic
1074358536 10:112806742-112806764 AAAATTAAAAAAAATTAGGCAGG - Intronic
1074567093 10:114589701-114589723 AAAAGAAAAAAGAAAGAGCCAGG - Intronic
1074640443 10:115372813-115372835 ATGAGCAAAAAGAACGAAGCTGG - Intronic
1074831467 10:117252601-117252623 AAGAAGAAAGAGAATGAGGGAGG + Intronic
1075103874 10:119524433-119524455 AACACTCAAAAGAATAAGGCAGG + Intronic
1075318570 10:121471258-121471280 AAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1075684746 10:124355704-124355726 AAAAATAGAAAGAATGAGGCAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076558474 10:131345644-131345666 AAAAGGAAAAAGGAGGAGGCAGG + Intergenic
1076751084 10:132543575-132543597 AAAAGTAAAAAGAATTAGCTGGG - Intronic
1077125005 11:929633-929655 AAGAGAAAAAAGAATTAGCCAGG + Intronic
1077513317 11:2983995-2984017 AAAAAAAAAAAAAATGAGGCTGG + Intronic
1077620672 11:3719918-3719940 AAAAGTAAAGAAAATGAGCCAGG - Intronic
1077662567 11:4082729-4082751 AAGAGGAAAAAGAGAAAGGCAGG - Intronic
1077695816 11:4392269-4392291 AAGAATAAAAATAATGGGTCAGG + Intronic
1077822441 11:5761258-5761280 AAGATTAAAAAGACTGACTCTGG - Intronic
1077942001 11:6852560-6852582 AAGAGTAGAAAGAGGGAGACTGG + Intergenic
1078011886 11:7578768-7578790 AAGAGCAGTAAGAATGAGTCAGG + Intronic
1078038152 11:7830241-7830263 AAGTGTGAAAATAATGTGGCTGG - Intergenic
1078173541 11:8950137-8950159 AAGAAAAAAAAAAAGGAGGCAGG + Intronic
1078411943 11:11130215-11130237 AAAAATATTAAGAATGAGGCAGG + Intergenic
1078524582 11:12090731-12090753 AAAAGAAAAAAGAAGGAGCCAGG + Intergenic
1078941419 11:16010602-16010624 AAGAGAAAAAAGAAACAGGATGG + Intronic
1079160621 11:17989917-17989939 AAAAGTAAAAAGAAACAGGTGGG - Intronic
1079210917 11:18460132-18460154 TAGAGTAAAAAGATCCAGGCTGG + Intronic
1079426495 11:20347335-20347357 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1079539028 11:21549917-21549939 GAGTGGAAAAAGAGTGAGGCAGG + Intronic
1079740775 11:24057163-24057185 AAGAATAAAGAAAATGAGGTAGG + Intergenic
1080543208 11:33289282-33289304 AAGAAAAAAAATAATGAGCCAGG + Intronic
1080613194 11:33923165-33923187 AAAAGTAAAAAGAAACAGGCAGG - Intergenic
1080797268 11:35576348-35576370 AAAAATAAATAAAATGAGGCTGG + Intergenic
1080830280 11:35887344-35887366 AAGAGAGAAAAAAATGAGACAGG - Intergenic
1081222849 11:40483299-40483321 AAGAGAAAAAAGAATTATCCAGG + Intronic
1081463565 11:43295097-43295119 CTGAGCAAAAAGAATGAAGCTGG + Intergenic
1081516448 11:43835403-43835425 TACAGTACAAAGATTGAGGCAGG + Intronic
1081529041 11:43945335-43945357 GAGAGAGAAGAGAATGAGGCTGG - Intergenic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082048811 11:47753312-47753334 AAAAATAAAAAAAATTAGGCTGG + Intronic
1082220340 11:49627607-49627629 AAGACTGAAAAAAATGAGACAGG - Intergenic
1082952057 11:58827866-58827888 ACAAGAAAAAAGAAGGAGGCCGG - Intergenic
1083181568 11:60989122-60989144 AAGAGTAGAAAGAGTGAATCTGG + Intronic
1083369656 11:62168004-62168026 AAAAATCAAAAAAATGAGGCAGG - Intergenic
1083451285 11:62747152-62747174 AATAATAAATAAAATGAGGCTGG + Intergenic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1083639917 11:64139959-64139981 AAAAGAAAAAAAAAAGAGGCAGG + Intronic
1083692230 11:64416661-64416683 TAAATTATAAAGAATGAGGCTGG + Intergenic
1083868727 11:65473503-65473525 AACAATAAAAAGAGTGAGGTAGG + Intergenic
1084140777 11:67227201-67227223 CAGACTACAAAGTATGAGGCAGG + Intronic
1084389255 11:68864507-68864529 AAAAGTGAAAGAAATGAGGCTGG + Intergenic
1084630551 11:70345664-70345686 AAAATTAAAAAAAATGAGCCAGG + Intronic
1084653207 11:70500966-70500988 AAGAAACAACAGAATGAGGCAGG - Intronic
1084886585 11:72212838-72212860 AAGAATAAAAAAAATTAGCCAGG - Intergenic
1085039903 11:73320819-73320841 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1085420823 11:76357575-76357597 AAAAGGAACAAGAATCAGGCTGG + Intronic
1085592241 11:77774753-77774775 AAGAAAAAAAAGAAAGAAGCAGG - Intronic
1085879145 11:80444918-80444940 AAAAGTAAAACAAACGAGGCTGG - Intergenic
1085935236 11:81133712-81133734 AAGAGGAAAGAGAATGAGTCTGG + Intergenic
1086047293 11:82547878-82547900 AAGAGAAAAAAGAAAGAGGAGGG + Intergenic
1086610125 11:88745500-88745522 AAGAGTAAAGAGTATCAGGCTGG - Intronic
1086785356 11:90962864-90962886 ATGAGTAAAAAGAATAAAGCTGG + Intergenic
1087055813 11:93934913-93934935 AAGACTCAAAAGGATGAGGCTGG + Intergenic
1087243987 11:95812601-95812623 AAAAATAAAAAAAATTAGGCAGG - Intronic
1087552988 11:99675384-99675406 AAGAGTAAAAAAATGCAGGCTGG + Intronic
1087949663 11:104205222-104205244 AAAAATAAATAGCATGAGGCTGG + Intergenic
1088150247 11:106736571-106736593 ATGAGCAAAAAGAATAAGACTGG - Intronic
1088367582 11:109055392-109055414 AAGAGTGGCAAGAATAAGGCAGG + Intergenic
1088506544 11:110532949-110532971 AAAAATAAAAAAAATGAGCCAGG + Intergenic
1088554079 11:111043893-111043915 AAGAGTAAATAGAATGCCACAGG - Intergenic
1088563913 11:111147215-111147237 AAGAGTAAAGAGATCAAGGCTGG + Intergenic
1088700991 11:112411509-112411531 AAGAGGAAAAAATATGAGACAGG + Intergenic
1089433241 11:118438750-118438772 ACGATTAAAAAAAAGGAGGCAGG - Intronic
1089473930 11:118743130-118743152 AAAAGTACAAAAAATGAGCCGGG + Intergenic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1089495321 11:118905523-118905545 AAAAAAAAAAAGAATCAGGCCGG + Intronic
1089927075 11:122269858-122269880 AAAAGAAAAAAGAAAGAGACAGG + Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090600409 11:128364067-128364089 AAGAGAAGAAAGAGTTAGGCAGG + Intergenic
1090648156 11:128783051-128783073 AAGAATAATAAGAGTGTGGCAGG + Intronic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091241186 11:134053544-134053566 AAGAATAAACAGCAAGAGGCAGG + Intergenic
1091506210 12:1071802-1071824 AAAAGTATAAAGTCTGAGGCTGG + Intronic
1091607939 12:1972854-1972876 AAGAGAGAAAAGAAAGAGGAAGG + Intronic
1091637390 12:2207651-2207673 AAAAGTAAAAAAAATTAGTCAGG + Intronic
1091782016 12:3219856-3219878 AAAAAAAAAAGGAATGAGGCTGG + Intronic
1092036307 12:5338193-5338215 AATAGTAATAATAATTAGGCAGG + Intergenic
1092266864 12:6988261-6988283 AAAAATAAAAAGAATGCAGCAGG + Exonic
1092288265 12:7142522-7142544 AAGAGTCAAAACAAGGAGGGAGG - Intronic
1092320067 12:7462601-7462623 CTAAGTAAAAAGAATGAAGCTGG - Intronic
1092374207 12:7941950-7941972 TAAAGTAAAAACTATGAGGCAGG - Intergenic
1092606588 12:10126950-10126972 AAGAAGAAATAGAATGAGGGAGG + Intronic
1092630848 12:10374673-10374695 GATATTAAAAAGAATGAGGCCGG - Intronic
1092685652 12:11042612-11042634 AAAAAAAAAAAGAATGAGCCTGG - Intronic
1092873921 12:12831999-12832021 AGGAGTAAAGAGTAGGAGGCAGG + Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092961017 12:13597166-13597188 AAGATTAAAAGTAGTGAGGCAGG + Intronic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1094111046 12:26863098-26863120 AAAAGTAAATAGAATCAGGCAGG - Intergenic
1094265476 12:28554528-28554550 TAGAGTAGAAAGAAGCAGGCAGG - Intronic
1095114147 12:38332005-38332027 AAGAGTAAACAAAAGAAGGCAGG - Intergenic
1095132799 12:38563990-38564012 AACAGTAAAAAGAAAGAATCAGG - Intergenic
1095249376 12:39960733-39960755 AAAAAAAAAAAGAATGAGACAGG - Intronic
1095966353 12:47869734-47869756 AAGATTAAAAAAAATTAGCCAGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096126463 12:49123369-49123391 AAGAAAAAAAAGAATCTGGCTGG + Intergenic
1096274062 12:50190674-50190696 AAAAAAAAAAAAAATGAGGCCGG - Intronic
1096306164 12:50479078-50479100 AAGAACAAAAAGAATGTTGCTGG + Exonic
1096363459 12:51008041-51008063 AAAAATAAAAATAATGAGCCTGG + Intronic
1096391587 12:51233529-51233551 AAAAAAAAAAAAAATGAGGCTGG - Intergenic
1096479339 12:51927784-51927806 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
1096556526 12:52407284-52407306 AGGAGGAAAGAGAGTGAGGCGGG - Intergenic
1096688055 12:53301971-53301993 AAAAATAAAAAAAATGAGGCTGG - Intronic
1096736777 12:53661678-53661700 AAAAAAAAAATGAATGAGGCCGG - Intronic
1096986755 12:55764538-55764560 AAAAAAAAAAAGAATAAGGCTGG + Intronic
1097040988 12:56155792-56155814 CAGAGGAAAAGGGATGAGGCGGG + Intronic
1097285792 12:57876244-57876266 GAGAGCAAAAAGAGTGAGGCAGG + Intergenic
1097333437 12:58356647-58356669 ATGAAAAAAATGAATGAGGCTGG + Intergenic
1098277991 12:68832671-68832693 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1098884763 12:75949395-75949417 AAGAAAAAAAAAAAAGAGGCCGG - Intergenic
1099369145 12:81809100-81809122 AGGAGGAAAAAGAAAGAGGGGGG - Intergenic
1099676277 12:85764783-85764805 AAGAATAAAAGGAAGGAGGAAGG + Intergenic
1100307450 12:93364021-93364043 AGGGGAAAAAAAAATGAGGCAGG - Intergenic
1100595954 12:96072341-96072363 AAGAGTATATAGAATGACACTGG + Intergenic
1100694208 12:97073766-97073788 CAAAGGAAAAAGAATAAGGCAGG - Intergenic
1100787003 12:98089324-98089346 TAGAATAAAGTGAATGAGGCAGG - Intergenic
1100949207 12:99826956-99826978 AAGAATAAAAAAAATTAGTCAGG + Intronic
1101108867 12:101466387-101466409 AAAAAAAAAAAAAATGAGGCTGG + Intergenic
1101221568 12:102646770-102646792 AAAAAAAAAAAGACTGAGGCAGG + Intergenic
1101299584 12:103465007-103465029 AAAAGTAAAAAGAACAAAGCTGG - Intronic
1101465072 12:104940306-104940328 AAAAATAAAAATAATAAGGCTGG - Intronic
1101537059 12:105628243-105628265 ATGAGAAAAAAGAAAGAGGGGGG + Intergenic
1101705131 12:107214491-107214513 GAGAGGAAAGAAAATGAGGCAGG + Intergenic
1101902743 12:108802955-108802977 ATGAGTAAAATAAATGAGGCTGG + Intronic
1101923599 12:108953042-108953064 AAGAAAGAAAAGAATGAGGAAGG + Intronic
1102155880 12:110727364-110727386 AAGAGAGAATAGAAAGAGGCAGG - Intronic
1102165757 12:110805261-110805283 AAAAAAAAAAAAAATGAGGCTGG - Intergenic
1102310443 12:111840913-111840935 AAGTATAAAAAGGATGAGGTTGG - Intergenic
1102331467 12:112035455-112035477 AAGAGTACAAAGTTCGAGGCTGG - Intronic
1102454061 12:113060762-113060784 AGGAGAAAACAGAATGGGGCGGG - Intronic
1102894687 12:116589289-116589311 AAAAATAAAAATAATGAGCCAGG + Intergenic
1102906992 12:116684297-116684319 AAGAAAAAAAAGAATGAAGAAGG + Intergenic
1103097289 12:118142350-118142372 AAAAGTAAAAAAAATTAGCCGGG - Intronic
1103542429 12:121675388-121675410 AAAAATAAAAATAATGAGGCCGG - Intergenic
1103876344 12:124130442-124130464 AAAATTCAAAAAAATGAGGCAGG - Intronic
1104557469 12:129814222-129814244 AGGAGAAAAAAGAATGAAACTGG + Intronic
1104603882 12:130173151-130173173 AAGAATAAAAAGAAAGATCCAGG - Intergenic
1104865779 12:131952746-131952768 AACAATAAAAAGAAACAGGCTGG - Intronic
1105208442 13:18242692-18242714 AAGAGAAAAAAATATGATGCCGG + Intergenic
1105250239 13:18692658-18692680 AAGAGGATAAAGTATGAGGAAGG - Intergenic
1105846118 13:24295449-24295471 AAAAGTAAAAAAAATCAGCCAGG + Intronic
1106053729 13:26218234-26218256 AAGATTAAAAAGAAGCATGCTGG + Intronic
1106384200 13:29268204-29268226 ATGAGTAGCAAGAATGAGGAAGG + Intronic
1106775721 13:33007375-33007397 AAGAGGAGAAAGAAAGAGGTGGG - Intergenic
1107321045 13:39188876-39188898 AAAAATACAAAGAATTAGGCAGG - Intergenic
1107387129 13:39923764-39923786 AAAAATAAAAAGAATTAGCCTGG - Intergenic
1107435725 13:40379248-40379270 AAGAATTAAAAGAACGAAGCAGG - Intergenic
1107452429 13:40521988-40522010 AAGGGCAAAAACACTGAGGCAGG - Intergenic
1107739319 13:43432480-43432502 AATAGAAAAAAAAATGAGGTGGG + Intronic
1108136955 13:47374650-47374672 AAGAGTAAATAAAATCTGGCCGG - Intergenic
1108798649 13:54065880-54065902 AAGAGTATAAAAAATCAGGCTGG + Intergenic
1109516744 13:63452917-63452939 CTGAGCAAAAAGAATGAAGCTGG + Intergenic
1110445054 13:75570747-75570769 AAGAGTAATAAAAATTAGCCAGG + Intronic
1110533907 13:76628939-76628961 AAAAGTAAAAAAAATTAGTCGGG + Intergenic
1110536797 13:76659884-76659906 ATAATGAAAAAGAATGAGGCCGG + Intergenic
1110848864 13:80221363-80221385 ATGAGAAAAAAGCATGAGTCAGG + Intergenic
1111106901 13:83657224-83657246 AAGAGGGAAATGAATGAGGTAGG + Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112122910 13:96433020-96433042 AATAGTAAGAAAAATGAAGCTGG + Intronic
1112316686 13:98369342-98369364 AAAAAAAAAAAGAATTAGGCTGG - Intronic
1112402901 13:99091039-99091061 AATAGTAAAAAAAATTAGGTGGG - Intergenic
1113186911 13:107698101-107698123 ATCAGTAAAAAGAATGAGGATGG - Intronic
1113653128 13:112051817-112051839 TTGAGAAAAAAGAATGGGGCAGG + Intergenic
1114070404 14:19100595-19100617 AAGACTAGAAAGCATGAAGCAGG + Intergenic
1114080632 14:19199581-19199603 AAGACAAAAAGGTATGAGGCTGG + Intergenic
1114091857 14:19299404-19299426 AAGACTAGAAAGCATGAAGCAGG - Intergenic
1114431221 14:22662893-22662915 AAAAGGAAAAAAAATAAGGCTGG - Intergenic
1114528968 14:23383379-23383401 AAGAGTAAAATGATGGAGGAGGG - Intronic
1114695698 14:24625205-24625227 TTGAGTAAAAAGAATAAAGCTGG + Intergenic
1115055372 14:29119999-29120021 AAGCGCCAAAAGACTGAGGCCGG + Intergenic
1115116622 14:29888142-29888164 AAAAATAAAAATAATTAGGCAGG + Intronic
1115254243 14:31381622-31381644 AAAAATAAAAAGAATTAGCCAGG + Intronic
1115375226 14:32667815-32667837 TAGAGAGAAAAGAATGAAGCAGG - Intronic
1115576826 14:34719477-34719499 AAAAATAAAAAAAATCAGGCGGG + Intergenic
1115676830 14:35685532-35685554 AAGCCTAAAAAGAAAGGGGCGGG + Intronic
1115692689 14:35861113-35861135 AAGAGAAATAAGAATGAGAATGG + Intronic
1116012726 14:39369630-39369652 AACAGTAAAAAGAATAAAGGAGG - Intronic
1116090951 14:40306630-40306652 TAGAGTGAAAAGACTGAGGAAGG + Intergenic
1116096170 14:40371825-40371847 AAGAGTAAAGAAAATGATGGAGG - Intergenic
1116148795 14:41110618-41110640 AAAAGTAAAAAAAATTAGCCGGG + Intergenic
1116187855 14:41621523-41621545 ATGTGTAAAAAGAGTGAGACAGG + Intronic
1116307518 14:43277360-43277382 AAGACCAAGAAGAATAAGGCAGG + Intergenic
1116541559 14:46107832-46107854 AAAAAAAAAAAGAATGAGGCAGG - Intergenic
1116763230 14:49040056-49040078 AAGTGTACAAAAAATTAGGCTGG - Intergenic
1116935576 14:50736431-50736453 AAGAGTTATAAAAGTGAGGCTGG - Intronic
1117078435 14:52127249-52127271 AAAAGTAAAAAAAATTAGCCGGG + Intergenic
1117123257 14:52592266-52592288 AACAGCAAAAAGAACGAAGCTGG - Intronic
1117652805 14:57924420-57924442 GAAAGTAAAGAGAATGAGCCTGG - Intronic
1118338037 14:64871359-64871381 AAGAGTAGAAAAAAAGAGACTGG + Intronic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118368840 14:65118747-65118769 AAAAGTAATATGAATGAGGCAGG + Intergenic
1118518543 14:66553869-66553891 AAGAGTACAATAACTGAGGCTGG - Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118757467 14:68855390-68855412 AAGAGCAACAACAGTGAGGCAGG + Intergenic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119250606 14:73150326-73150348 AAGAGGAAAAAGAATGGGGGAGG - Intronic
1119292199 14:73504401-73504423 AAAAATAAAAAAAATTAGGCGGG - Intronic
1119404836 14:74391647-74391669 GACATTAAAAAGAATGAAGCAGG - Intergenic
1119696461 14:76717407-76717429 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
1119747906 14:77057466-77057488 AGAGTTAAAAAGAATGAGGCTGG - Intergenic
1119832272 14:77714164-77714186 AAGAGTACAAAAAATTAGTCAGG - Intronic
1120008832 14:79390154-79390176 AAGAATACAAAAAATTAGGCGGG + Intronic
1120010365 14:79406460-79406482 AAGAGAAAAAAAAATTAGCCAGG - Intronic
1120592740 14:86394986-86395008 AAGAAAAAAAAGAAAAAGGCTGG + Intergenic
1120629748 14:86875200-86875222 TAAAGAAAAAAGAAAGAGGCCGG - Intergenic
1120915967 14:89710738-89710760 AAGAGAAGAAAGATGGAGGCTGG - Intergenic
1121032758 14:90673430-90673452 AAGAGAAAAAAGAAGGAGCGCGG + Intronic
1122021484 14:98841470-98841492 AAGAGCAAAAAGAATTGGGAGGG + Intergenic
1122487877 14:102093942-102093964 AAAAGAAAAAAGACTCAGGCTGG - Intronic
1122685391 14:103502333-103502355 AGGAGGAAAAACAATGAGGTGGG + Intronic
1122705203 14:103616545-103616567 AAGAATACAAAAAATTAGGCAGG + Intronic
1122713431 14:103677977-103677999 AAAAAAAAAAAGCATGAGGCTGG + Intronic
1123181630 14:106476785-106476807 AAGAGAAGAATGAATGAGACAGG - Intergenic
1202831018 14_GL000009v2_random:30467-30489 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1202945274 14_KI270726v1_random:19943-19965 AAGAGAAGAATGAATGAGACAGG + Intergenic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1123401777 15:19994531-19994553 AAGAGAAGAAGGAATGAGACAGG - Intergenic
1123418110 15:20107268-20107290 GGGAGAAAAAATAATGAGGCAGG + Intergenic
1123511117 15:21001192-21001214 AAGAGAAGAAGGAATGAGACAGG - Intergenic
1123527328 15:21113790-21113812 GGGAGAAAAAATAATGAGGCAGG + Intergenic
1123838342 15:24220414-24220436 AACAGAAAAAAAAATGAGCCAGG - Intergenic
1123860669 15:24463072-24463094 AAGAGAAACAGGACTGAGGCGGG + Intergenic
1123966405 15:25463999-25464021 AGGAGAAAAGAGAATGAGACGGG + Intergenic
1124035891 15:26053357-26053379 AAAAGGAAAAAGAAAGAGGGAGG + Intergenic
1124430050 15:29599247-29599269 AAGAGAAATAATAATGATGCAGG + Intergenic
1124499772 15:30217256-30217278 AAGAGTATAAAAAATGGGGGAGG + Intergenic
1124826596 15:33102512-33102534 AAAAGAAGAAAGAATGAGGAAGG - Intronic
1124938121 15:34192241-34192263 AAAAGTACAAAAAATGAGACAGG + Intronic
1124990154 15:34665172-34665194 AAAACTAAAAAAAATTAGGCAGG - Intergenic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1126583292 15:50260315-50260337 AAAACAAAAAAGAAGGAGGCCGG - Intronic
1126753265 15:51898880-51898902 AAGTGAAAAAAGAAAGAGGAGGG - Intronic
1126820069 15:52494062-52494084 TAGACAGAAAAGAATGAGGCAGG + Intronic
1126827023 15:52561848-52561870 GAAAGTAAAAAGACTGAGGGTGG + Intronic
1127006900 15:54581055-54581077 AAGAGAAAAAAGAATCATCCAGG + Intronic
1127017671 15:54707454-54707476 AAAAGTAAAAGGAAAGAGGGCGG - Intergenic
1127141405 15:55981359-55981381 AAAAGAAAAAAAAAGGAGGCCGG - Intronic
1127232114 15:57008063-57008085 AAGAGGCAAAAGCATGAGGATGG - Intronic
1128064671 15:64756962-64756984 AAAAAAAAAAAAAATGAGGCCGG - Intronic
1128086130 15:64888043-64888065 AAAAGTAAAAAAAATTAGCCAGG + Intronic
1128265839 15:66266018-66266040 AAAAATAAAAAAAATTAGGCTGG - Intergenic
1128286794 15:66443939-66443961 AAGAGTAAAAAATAAGGGGCTGG + Intronic
1128302154 15:66572882-66572904 AAAAGTAAAAAAAAAGAGGCTGG + Intergenic
1128829570 15:70755371-70755393 AAAAAAAAAAAGAATGAGGCCGG + Intronic
1128913790 15:71541017-71541039 AAAAGTAAATAAAATGAGGCTGG - Intronic
1129001065 15:72334329-72334351 AATGTTATAAAGAATGAGGCTGG - Intronic
1129285675 15:74522640-74522662 AAAAAAAAAAAGAATGAGGCTGG + Intergenic
1129343776 15:74903627-74903649 AAAAGAAAAATAAATGAGGCTGG + Intronic
1129592052 15:76924777-76924799 AAGAAGAAAAAGAATGTGGGAGG - Intergenic
1129983908 15:79898967-79898989 AAGAGTCAGAAAAATTAGGCCGG + Exonic
1130378528 15:83352214-83352236 AACAGCAGAAAGAATGAGGAAGG + Intergenic
1130684779 15:86027372-86027394 AAGAATAGAAAGAGTGAGGCAGG - Intergenic
1130717776 15:86352780-86352802 AAGAGTAAAGAAAAAGTGGCTGG - Intronic
1130815240 15:87425005-87425027 AAGATTCAGAAGAATGAGCCTGG - Intergenic
1130871237 15:87973849-87973871 AAGAGCAAAATGAAGGTGGCAGG - Intronic
1130886139 15:88094168-88094190 AAGAATAAAAAGAAGTCGGCCGG + Intronic
1131036419 15:89225335-89225357 AAAAGTAAAAAGAAACAGGTGGG - Intergenic
1131161985 15:90111709-90111731 AAAAAAAAAAAGAATGAGGTAGG + Intergenic
1131621852 15:94076692-94076714 AAGAACAAAAAGAATGTTGCTGG + Intergenic
1131646451 15:94350134-94350156 TAGAGTATAAAGAAAGATGCTGG + Intronic
1131709600 15:95038390-95038412 AAGAATAAAAAGAGTAAGGCTGG + Intergenic
1131830290 15:96350374-96350396 AAAAATAAAAAGAATGAGAAGGG + Intergenic
1131890127 15:96963666-96963688 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
1132000320 15:98172930-98172952 AAGAGTAAAAACAGAGAGGGTGG - Intergenic
1133161768 16:3916608-3916630 AAAAATAAAAAAAATGAGACAGG - Intergenic
1133244166 16:4436302-4436324 AAGATTGAAAAGATGGAGGCTGG + Intronic
1133671855 16:8030546-8030568 AAGAGAAAAATGAGTGATGCTGG + Intergenic
1134000478 16:10779063-10779085 AAAAGAAAAAAGAAAGAAGCGGG - Intronic
1134139141 16:11701951-11701973 AATGTTAAAAACAATGAGGCAGG + Intronic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134475578 16:14570679-14570701 AAAAGAAAAAGGAAAGAGGCTGG + Intronic
1134597256 16:15505725-15505747 AAAAGTACAAAAAATTAGGCTGG + Intronic
1135139418 16:19908735-19908757 AAAAGTAAAAAAAATTAGGCAGG + Intergenic
1135333001 16:21576576-21576598 AAAAGTAAAAAGACTTAGGTTGG + Intergenic
1135483200 16:22840541-22840563 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1135746978 16:25025696-25025718 AAGAATTTAAAGAATGAGGCTGG - Intergenic
1135857771 16:26027970-26027992 AAGATTAAAAAGAATAAGAGAGG + Intronic
1135984079 16:27170866-27170888 AAAAGTAAAAAGAATTAGCCGGG - Intergenic
1135985135 16:27178603-27178625 AAAATTTAAAAGACTGAGGCTGG - Intergenic
1136202775 16:28699838-28699860 AAAAGAAAAAAAAAAGAGGCTGG - Intronic
1136457554 16:30389982-30390004 AAAAGAAAAAAGAATTAGCCAGG - Intronic
1136536547 16:30902989-30903011 AAGAGTTAAGAGAACGGGGCAGG - Exonic
1136555755 16:31006948-31006970 AAAAGCAAAAAGAATTAGCCAGG + Intronic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136901689 16:34046479-34046501 AAAAGTAAAAAGGAAGAGGAGGG - Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1137839420 16:51626248-51626270 AAAAATAAAAAAAAAGAGGCCGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138364867 16:56466809-56466831 AAGAGTAAAATGAGGCAGGCTGG + Intronic
1138437733 16:57014909-57014931 AAAAGGAAAAAGGAAGAGGCTGG - Intronic
1138655996 16:58491754-58491776 AAAAGTGAAAAGGATGGGGCTGG - Intronic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1139038570 16:62977149-62977171 AAGAAAAAAATGAATGAGGAGGG + Intergenic
1139191698 16:64871298-64871320 AAGATTAAAAAGTATGAAGGAGG + Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139219707 16:65168662-65168684 AAGATTAAAAATAAATAGGCCGG - Intergenic
1139443505 16:66981508-66981530 AAAAGTAAAAAAGATGAGCCAGG - Intergenic
1139453293 16:67049496-67049518 AAAAATAAACAGAATGGGGCCGG - Intronic
1139605167 16:68013104-68013126 AAGAGGAGGAAGAAAGAGGCTGG + Intronic
1139633388 16:68244212-68244234 AAAAGAAAAAAGAAAGAGGGAGG + Intergenic
1139849897 16:69944842-69944864 AAGAAAAAAAAGAATAGGGCCGG + Intergenic
1139854611 16:69970476-69970498 AAGAATAAAGAAACTGAGGCCGG + Intergenic
1139883594 16:70193390-70193412 AAGAATAAAGAAACTGAGGCCGG + Intergenic
1140022530 16:71252125-71252147 AAGAATAAATAGCAAGAGGCAGG + Intergenic
1140278883 16:73535881-73535903 AAAAGTAAAAAAAATTAGCCGGG - Intergenic
1140368917 16:74402126-74402148 AAGAATAAAGAAACTGAGGCCGG - Intergenic
1140463198 16:75158212-75158234 AAAAGAAAAAAGAAACAGGCTGG - Intronic
1140496965 16:75397642-75397664 AAAAGTAAAAAAAATTAGCCGGG + Intronic
1140810273 16:78570467-78570489 AAAATTAAAAAAAATTAGGCAGG - Intronic
1140937115 16:79683278-79683300 AAGAGTTAAAACAATGGGCCGGG - Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141484208 16:84328154-84328176 AAGAGTGAAAGTACTGAGGCAGG + Intronic
1141486927 16:84346625-84346647 AAGAATAAACTGATTGAGGCCGG - Intergenic
1141981687 16:87554354-87554376 AAAAATAAAAAAAATGAGCCAGG - Intergenic
1142067179 16:88069295-88069317 AAAAGAAAAAAGAAAAAGGCAGG - Intronic
1142576198 17:909698-909720 AAAAATAAAAAAAATTAGGCCGG - Exonic
1142598869 17:1043326-1043348 AAGATTAAAAAAAATTAGCCGGG - Intronic
1142778990 17:2165742-2165764 AAAAGTAAAAATAATTAGCCAGG + Intronic
1142801264 17:2347401-2347423 AAAAAAAAAAAAAATGAGGCCGG - Intronic
1143229322 17:5338716-5338738 AATAGGAAAATGAATGAGACGGG - Intronic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143761819 17:9110264-9110286 AAAAGAAAAAAAAAAGAGGCAGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144055141 17:11533885-11533907 TAGAGTAAGAATAATGAGGCTGG - Intronic
1144488708 17:15688779-15688801 AAGAAAAAAAAAAAAGAGGCCGG + Intergenic
1144553175 17:16259528-16259550 GAAAGAAAAAAGAATGAAGCTGG + Intronic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1144969350 17:19097786-19097808 AAAAAAAAAAAGAATGTGGCCGG - Intergenic
1144978566 17:19154279-19154301 AAAAAAAAAAAGAATGTGGCCGG + Intronic
1144989656 17:19223953-19223975 AAAAAAAAAAAGAATGTGGCCGG - Intronic
1145071228 17:19809933-19809955 AAGAAAAGAAATAATGAGGCAGG + Intronic
1145304691 17:21667036-21667058 AGGAGCAGAAAGAATGAGGGAGG - Intergenic
1145877789 17:28332862-28332884 GAGAGGAAAAAGAATGGAGCTGG + Intronic
1146542368 17:33708518-33708540 AAGAGAAGAAAGAAGGAGACAGG - Intronic
1146626716 17:34440438-34440460 ATGAGCAAAAATAAAGAGGCAGG - Intergenic
1147112807 17:38276297-38276319 AAGAGGAAAAAAAATGAATCTGG + Intergenic
1147497669 17:40933235-40933257 AAGAGGAAAAAGAATGAGGCAGG - Intronic
1147514137 17:41100296-41100318 AAGAGTAAAACGAGGGAGTCAGG - Intronic
1147551710 17:41447687-41447709 TAGAGTAGACAGCATGAGGCTGG - Intergenic
1147840840 17:43370343-43370365 AAGATTAAAATAATTGAGGCTGG + Intergenic
1147848705 17:43424458-43424480 AAAAGTAAAAATAATTAGCCAGG + Intergenic
1147948424 17:44093304-44093326 AAGAGCAAAGAGAGTAAGGCAGG - Exonic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148164442 17:45473290-45473312 AGAAAAAAAAAGAATGAGGCTGG + Intronic
1148202384 17:45757896-45757918 AAGAGTAAAGAGAAAGAGCCAGG + Intergenic
1148416812 17:47512946-47512968 AAGAGGAAAAAAAATGAATCTGG - Intergenic
1148476582 17:47932707-47932729 AAAAATACAAAAAATGAGGCTGG - Intergenic
1148539785 17:48471222-48471244 AAAAAAAAAAAGACTGAGGCAGG + Intergenic
1148585111 17:48772433-48772455 AAGAATTAAAAGAATATGGCTGG + Intronic
1149465964 17:56879331-56879353 AAGAAAAAAGAGAGTGAGGCTGG + Intergenic
1149594204 17:57854246-57854268 AAAAATAAAAAAAATTAGGCGGG + Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149883317 17:60315099-60315121 TATAATAAAATGAATGAGGCCGG + Intronic
1149940706 17:60862295-60862317 AACAAAAAACAGAATGAGGCTGG + Intronic
1150042213 17:61876007-61876029 AAAACTAAAAAAAATTAGGCAGG + Intronic
1150104166 17:62449784-62449806 AAGAATTAAAAGAATTTGGCCGG + Exonic
1150250746 17:63703204-63703226 AAAGTTAAATAGAATGAGGCTGG + Exonic
1150309365 17:64115253-64115275 AACAGGAAGAAGTATGAGGCAGG - Intronic
1150331983 17:64301796-64301818 AATAGAAAAAAGACTGAGGCTGG + Intergenic
1150430350 17:65110689-65110711 AAGACAAAAAAGAAGGAGGCCGG - Intergenic
1150441140 17:65192453-65192475 AAGAATAAAAAAAATTAGCCAGG + Intronic
1150526906 17:65933146-65933168 AAAAGTAAAAAGAATAAAGAAGG + Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1151359509 17:73580236-73580258 AAGAGGGAGAGGAATGAGGCAGG - Intronic
1151467481 17:74296758-74296780 AAGAGGGAGCAGAATGAGGCTGG - Intronic
1151497054 17:74464456-74464478 AAAAATAAAAAAAATGTGGCGGG - Intergenic
1151594410 17:75068362-75068384 AAAAATACAAAGAATTAGGCTGG + Intergenic
1151635998 17:75348339-75348361 AATAGTAAACAGAATAGGGCTGG - Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151798481 17:76362908-76362930 AATAGTAAAAAAAATAAGGCTGG + Intronic
1151803067 17:76389010-76389032 AGGAGTGGAAAGAATGTGGCAGG + Intergenic
1151924869 17:77187672-77187694 TAGGGTAATAAGAATAAGGCCGG - Intronic
1151938268 17:77277279-77277301 AAAAGAAAAAAGAAAGAGGCCGG - Intergenic
1153216353 18:2824507-2824529 AAAAGTAAAATGGATAAGGCCGG - Intergenic
1153595217 18:6718348-6718370 TAGATTCAAAAGAATGGGGCAGG - Intergenic
1153706119 18:7747618-7747640 ATGAGTAAAAAGGCAGAGGCAGG - Intronic
1153759894 18:8320329-8320351 AGGAGTTAACAGATTGAGGCTGG + Intronic
1153785118 18:8527894-8527916 GATGTTAAAAAGAATGAGGCAGG + Intergenic
1154264801 18:12871751-12871773 TGTAGTATAAAGAATGAGGCAGG + Intronic
1154479216 18:14800483-14800505 AAAAATACAAAGAATGAGCCAGG - Intronic
1154480005 18:14811370-14811392 AAAAATACAAAGAATGAGCCAGG - Intronic
1155256588 18:24003124-24003146 TAGAGTATAGAGAGTGAGGCAGG - Intronic
1155344360 18:24843820-24843842 AAAAAAAAAAAAAATGAGGCTGG - Intergenic
1155366253 18:25051778-25051800 AAAAGAAAAAAAAATCAGGCAGG + Intergenic
1155595209 18:27478084-27478106 AAAAAAAAAAGGAATGAGGCTGG + Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1156144288 18:34157666-34157688 AAAAGTAAAAAGACTGAGAAGGG + Intronic
1156229690 18:35141233-35141255 AAGAGGAAGAGGAATGAGGCAGG - Exonic
1156409911 18:36817730-36817752 AAGAGTTTAAAGAATTTGGCCGG - Intronic
1157075661 18:44464551-44464573 AAAAGGATCAAGAATGAGGCAGG + Intergenic
1157157622 18:45283039-45283061 AGGAGGGAAAAGGATGAGGCAGG - Intronic
1157410023 18:47455663-47455685 AAAAGAAAAAAGAAAAAGGCAGG - Intergenic
1158079995 18:53578613-53578635 AAGATGAAAAATAAGGAGGCTGG + Intergenic
1158468579 18:57713784-57713806 AAAAATAAAAAAAATTAGGCCGG - Intronic
1158659593 18:59374180-59374202 ATGAGTAAAGGTAATGAGGCAGG + Intergenic
1159064798 18:63557884-63557906 AAAAGTAAAAAGAAACAGGTGGG + Intronic
1159099091 18:63938497-63938519 AAGAGAAAAAAAAATTAGCCGGG + Intergenic
1159121002 18:64170579-64170601 AAGATTAAAAGGAATTAGGGAGG - Intergenic
1159669647 18:71207467-71207489 AAGAGTAAAAAAAATTAGTATGG - Intergenic
1160170026 18:76545139-76545161 AAGAGTCAATAGGATGACGCTGG + Intergenic
1160402487 18:78621089-78621111 AAAAGTAAAAAAAAAGAGGCAGG - Intergenic
1160696541 19:487672-487694 AATAATAACAAGCATGAGGCAGG + Intergenic
1160700337 19:503597-503619 AAAAGTAAAAATAATGTGGTCGG + Intronic
1161082295 19:2317324-2317346 AAGAGAAAAGGGAATGAGACCGG - Intronic
1161092726 19:2370486-2370508 AAAAATAAAAATAATGAGCCAGG - Intergenic
1161114763 19:2490431-2490453 AAAAAAAAAAAAAATGAGGCTGG - Intergenic
1161184263 19:2905878-2905900 ACAAGGAAAAAAAATGAGGCTGG + Intronic
1161429551 19:4223723-4223745 AAAAGTAAAAAAAATTAGCCGGG - Intronic
1161598814 19:5167520-5167542 AAGAAAAAAAAAAAAGAGGCTGG + Intronic
1161640961 19:5422773-5422795 AAAAATAAAAATAATGAGCCTGG - Intergenic
1161782625 19:6303409-6303431 AAAAATATAAAAAATGAGGCAGG - Intergenic
1161876729 19:6917577-6917599 AAAAATATAAAGAATGAGCCTGG + Intronic
1161996506 19:7715715-7715737 AATAGTCAAAAGATTGAAGCAGG - Intergenic
1162070710 19:8150551-8150573 AAAATTAAAAAGAATTAGCCAGG + Intronic
1162404142 19:10463384-10463406 AAAAAAAAAAAGAATGGGGCTGG - Intronic
1162516239 19:11149582-11149604 AAAACTAAAAAAAATTAGGCTGG + Intronic
1162650743 19:12087055-12087077 AAGAGTACAAATTATTAGGCTGG - Intergenic
1162754837 19:12851780-12851802 CACAGTAAAAATAATGAGGCTGG - Intronic
1162803424 19:13123552-13123574 AAGAATGAAAAGAATGAAGAAGG + Intronic
1162813292 19:13177840-13177862 AAAATAAAAAAGAAAGAGGCGGG + Intergenic
1162827834 19:13264588-13264610 CAGAGGCAAAAGAATGTGGCTGG - Intronic
1162871199 19:13588041-13588063 AAGAAAAGAAAGAAAGAGGCCGG + Intronic
1162911623 19:13850767-13850789 AAGAGTCAAGAGTAAGAGGCAGG - Intergenic
1163140645 19:15345953-15345975 AAAAGAAAAAAAAAAGAGGCTGG + Intergenic
1163420503 19:17211433-17211455 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1163657432 19:18555340-18555362 AAAACAAAAAAGAAAGAGGCCGG - Intergenic
1163706174 19:18814746-18814768 AAAAAAAAAATGAATGAGGCTGG - Intergenic
1163761729 19:19140682-19140704 ACGAGGAAAAAAAAAGAGGCTGG + Intergenic
1164015314 19:21251301-21251323 AAAAAAAAAAAGAATGATGCTGG + Intronic
1164027887 19:21369805-21369827 AAAAAAAAAAAGAATGAAGCTGG - Intronic
1164801062 19:31077123-31077145 AAGTATAAAAATAATGAGGTGGG - Intergenic
1164851774 19:31490153-31490175 AAAAATAAAAAGAATGATCCAGG - Intergenic
1164932270 19:32184953-32184975 AACAGTACAAAGTGTGAGGCTGG + Intergenic
1165127008 19:33605289-33605311 AAAAATAAAAAAAAAGAGGCTGG + Intergenic
1165323775 19:35102165-35102187 AAAAATAAAAAAAATTAGGCCGG + Intergenic
1165490092 19:36118397-36118419 AAGAATAAAAAGAATTGGTCGGG + Intronic
1165619850 19:37236546-37236568 AAGAAGAAAAAGAATTAGCCAGG - Intronic
1165676548 19:37729818-37729840 AAGTATAAAAAAAATTAGGCAGG + Intergenic
1165887401 19:39088180-39088202 AAAAATAAAAAGAATTAGCCAGG - Intronic
1165912010 19:39235109-39235131 AAGAATAAAAAAAATTAGCCTGG - Intergenic
1166103519 19:40585834-40585856 AAGTGAAATAAGAAAGAGGCCGG - Intronic
1166191474 19:41179707-41179729 AAGAATAAAAAAAATGGGGCCGG + Intergenic
1166572987 19:43810787-43810809 AAAAGTACAAAGAATTAGCCAGG - Intronic
1166814033 19:45531084-45531106 AACAGTAAAAAAAAATAGGCTGG - Intronic
1166826073 19:45610031-45610053 AAAAGGAAAAAGAATTAGCCAGG - Intronic
1166848974 19:45748766-45748788 AAGCTTAAAAAGACTGAGGCTGG + Intronic
1167008577 19:46791180-46791202 AAGGGAAAAAAGATTTAGGCTGG + Intergenic
1167274164 19:48525679-48525701 AAGAAAAAAAAAAATCAGGCTGG - Intergenic
1167391028 19:49195056-49195078 AAAAGAAAAAAAAGTGAGGCTGG - Intronic
1167510464 19:49893083-49893105 AGGAGAAAAGAGCATGAGGCTGG + Intronic
1167585623 19:50373664-50373686 AAAATTAAAAAGAGTGAGACAGG - Intronic
1167723275 19:51193535-51193557 AAAAGAAAAAAGAAAAAGGCCGG + Intergenic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167783569 19:51616966-51616988 AAGATAAAAAAGAAATAGGCCGG + Intronic
1167831031 19:52022917-52022939 AAGAGTACAAAAAATTAGCCGGG + Intronic
1167835780 19:52068513-52068535 AAAAGTAAAAAAAATCAGCCGGG + Intronic
1168017934 19:53588314-53588336 AAAAGAAAAAAGAATGAAACTGG - Intergenic
1168047167 19:53802409-53802431 AAAAATAAATAGAATGCGGCCGG + Intronic
1168234359 19:55052651-55052673 AAAATAAAAAACAATGAGGCAGG - Intronic
1168524121 19:57075107-57075129 AAGAGAAAAAAAAATTAGCCGGG - Intergenic
1168550044 19:57285110-57285132 GTGAGTCAAAAAAATGAGGCTGG - Intronic
1202641677 1_KI270706v1_random:97306-97328 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1202664846 1_KI270708v1_random:108654-108676 AAAAATAAAAAAAATTAGGCTGG - Intergenic
1202674214 1_KI270710v1_random:26071-26093 AATAAAAAAAAGAATGAGGTTGG + Intergenic
1202677900 1_KI270711v1_random:24243-24265 AAGAATACAAAAAATTAGGCAGG - Intergenic
925339028 2:3121444-3121466 AAAATTAAAAAGAATTAGCCAGG + Intergenic
925429741 2:3780765-3780787 AAGATTAAAAACAATGAGATGGG + Intronic
925554672 2:5116923-5116945 AAAAAAAAAAAGAATGAGGAAGG + Intergenic
925936700 2:8770243-8770265 AAAAATAAAAAGAAAGAGCCAGG + Intronic
925975968 2:9142484-9142506 AAAAATAAAAAGAATTAGCCGGG - Intergenic
926559678 2:14402402-14402424 ATGATTACAAAAAATGAGGCAGG - Intergenic
927025639 2:19066143-19066165 AAAAGTAAAAATAATTAGTCGGG + Intergenic
927391469 2:22600228-22600250 AGGAGTAAAAAGGAGCAGGCTGG - Intergenic
927535914 2:23858478-23858500 AAAAAAAAAAAGAATGAGACAGG - Intronic
928141222 2:28731017-28731039 AAAAAAAAAAAAAATGAGGCAGG - Intergenic
928302677 2:30140467-30140489 GAGAATAAAAAGTTTGAGGCCGG + Intergenic
928520806 2:32086464-32086486 AAAAAAAAAAAAAATGAGGCCGG + Intronic
928866893 2:35927913-35927935 AAGAGCAAAAAGACAGAAGCAGG - Intergenic
928981086 2:37135789-37135811 AAAAATAAAAAGAATTAGCCAGG - Intronic
929037678 2:37710342-37710364 AAAAGTAAAAACAATGAGGGAGG + Intronic
929072808 2:38050614-38050636 AAGACAGAAAAGGATGAGGCAGG + Intronic
929074273 2:38065383-38065405 AAAAAGAAAAAGAAAGAGGCTGG + Intronic
929140419 2:38662098-38662120 AAAAGTAAAAAAAATTAGGCTGG - Intergenic
929269055 2:39952739-39952761 ATCTGTAAAAAGAATGAGGAAGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929521385 2:42654910-42654932 ATTAGTAGAAAGAAGGAGGCTGG - Intronic
929664205 2:43821277-43821299 AGGAGCAAAAAGAATGACTCTGG - Intronic
930041779 2:47130809-47130831 AAAAGAAAAAAAAATGTGGCTGG - Intronic
930155278 2:48100671-48100693 AAGAGTCAGAAAAATTAGGCAGG + Intergenic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930189072 2:48439987-48440009 AAAATTTAAATGAATGAGGCAGG + Intergenic
930307624 2:49695104-49695126 ACTAGTAAAGAGAAGGAGGCAGG - Intergenic
930443966 2:51446895-51446917 AAGAGTAGAAAGAATGAGAAAGG - Intergenic
930879800 2:56258209-56258231 AAGATGAAGAAGAATGAAGCTGG + Intronic
931020552 2:58040070-58040092 AAAAGTAAAAAAAATTAGCCAGG - Intronic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931697483 2:64882249-64882271 AAGAATAAAAAAAATTAGTCAGG + Intergenic
931737963 2:65215142-65215164 AAGAGAAAGATGAATGAGGTAGG + Intergenic
931834756 2:66086524-66086546 AAGAGAAAAAAAAATGATACAGG + Intergenic
932014719 2:68013091-68013113 AAAAATAAAAAAAATTAGGCAGG - Intergenic
932170438 2:69550589-69550611 AATAGAAAAAAAAAAGAGGCCGG - Intronic
932175154 2:69594045-69594067 AAGAATAAAAAGACTGAGGGAGG + Intronic
932343433 2:70980647-70980669 AAAAATAAAAAAAATTAGGCTGG + Intronic
932934750 2:76089437-76089459 AAAGGTGAAAAGAATGAGTCAGG - Intergenic
933024213 2:77234234-77234256 AATATTAAAAATAATGAGGGTGG - Intronic
933670656 2:85004348-85004370 AAAAGTACAAAAAATTAGGCAGG + Intronic
933680780 2:85098513-85098535 AAAAATAAAAAAAATTAGGCCGG + Intergenic
933920184 2:87038094-87038116 CACATTCAAAAGAATGAGGCTGG + Intergenic
933931440 2:87155692-87155714 CACATTCAAAAGAATGAGGCTGG - Intergenic
934002814 2:87731799-87731821 CACATTCAAAAGAATGAGGCTGG - Intergenic
934056165 2:88253116-88253138 AAGAGGAAAAAGAAAGAGAGAGG - Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934728953 2:96644180-96644202 AAAAAAAAAAAGAAAGAGGCTGG + Intergenic
935918962 2:107988621-107988643 CAGAGTAAAAACAAAGAGGTGGG + Intronic
936361680 2:111809747-111809769 CACATTCAAAAGAATGAGGCTGG + Intronic
936389418 2:112057816-112057838 AAAAAAAAAAAGACTGAGGCAGG - Intronic
936649856 2:114413664-114413686 AACAGTATAAACAAAGAGGCTGG - Intergenic
936690877 2:114887061-114887083 AAGAGTAGAAATAATGAAGGTGG - Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937600157 2:123721845-123721867 AAAAGTACAAAAAATTAGGCAGG - Intergenic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937790008 2:125949630-125949652 AAAAGTACAAAGAATTAGCCAGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938181252 2:129187153-129187175 CAGAGGAACAAGACTGAGGCTGG - Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938842792 2:135179259-135179281 AAGAAAGAACAGAATGAGGCTGG + Intronic
938879618 2:135571620-135571642 AAAAGTAAATAAAATTAGGCCGG - Intronic
938893840 2:135731754-135731776 AATAGAAAAAAGACTGAGGCAGG + Intergenic
938992712 2:136645681-136645703 AGGAGTGAAAGGAAGGAGGCAGG + Intergenic
939191358 2:138920256-138920278 AAAAGAAAAAGGAAGGAGGCTGG - Intergenic
939317806 2:140575625-140575647 AATTCTAAAAAGAATCAGGCTGG + Intronic
939603719 2:144226342-144226364 AAAGGTAAAAATAATGAGGGAGG + Intronic
940373865 2:152933829-152933851 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
941284326 2:163590711-163590733 AACAGTGAAAAGAATGAGAAAGG - Intergenic
941610437 2:167654790-167654812 AAAAAAAAAAAGAAAGAGGCTGG - Intergenic
941726350 2:168864852-168864874 ACGAGAAAAAAGAAGGAGGATGG + Exonic
942028833 2:171938089-171938111 AAGAGTAGAAACAATAGGGCAGG + Intronic
942032676 2:171978434-171978456 AAGAGTTAAAACCATAAGGCTGG - Intronic
942076596 2:172361935-172361957 AAAAGGAAAAAGAATGGGGTGGG + Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942611497 2:177746581-177746603 AAAAGGAAAAAGAATCAGTCTGG + Intronic
943045930 2:182862417-182862439 GACAGAAAAAAGAATGAGTCTGG - Intronic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943298563 2:186168620-186168642 AAAAATACAAAAAATGAGGCAGG + Intergenic
943709737 2:191077812-191077834 AAGAGAAAAAAGAAAGAGTTTGG - Intronic
943877884 2:193096438-193096460 AAAAATACAAAAAATGAGGCGGG + Intergenic
943970950 2:194405400-194405422 ATGAGCATAAAGAATGAAGCTGG - Intergenic
944077887 2:195752548-195752570 AAGATAAAAAAGAATAAGGTCGG + Intronic
945106982 2:206325578-206325600 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
946112428 2:217431710-217431732 AAGAGGGAAAGGACTGAGGCAGG - Intronic
946119691 2:217499032-217499054 AGGAGTAGAATGAATGAGGTCGG + Intronic
946261638 2:218497229-218497251 AAGATTAAAAAAAATTAGCCGGG - Intronic
946496970 2:220204684-220204706 AAGAGTACAGGGAATCAGGCCGG + Intergenic
946517003 2:220423463-220423485 AACAGTAGAAAGAATGAGAGTGG - Intergenic
946752500 2:222906610-222906632 AAAAAAAAAAAAAATGAGGCTGG - Intronic
947055509 2:226096330-226096352 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
947114465 2:226754011-226754033 AAAAATAAAAATAATTAGGCAGG - Intronic
947394371 2:229672589-229672611 GAGAGGAAAAAGGATGAGGGAGG + Intronic
947403357 2:229750384-229750406 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
947450315 2:230202451-230202473 AAAAGTACAGAGAATGAGGATGG - Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
948435139 2:237948198-237948220 AAAAAAAAAAAGAGTGAGGCAGG - Intergenic
948681862 2:239640522-239640544 AAGAGAAAAAGGAAAGAGGCAGG - Intergenic
948923286 2:241077214-241077236 ACATGCAAAAAGAATGAGGCCGG + Intronic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1169427957 20:5510874-5510896 AAAAGAAAAAAAAATGAGCCAGG + Intergenic
1169478213 20:5951081-5951103 AAGAGTAAAAAGAAACAGTTGGG - Intronic
1169799669 20:9502164-9502186 AAGAACAAAAAAAATGAGGGCGG - Intergenic
1169865859 20:10199338-10199360 AAGAGAAAAATGAATCAGCCTGG + Intergenic
1170063210 20:12282492-12282514 AAAAAAAAAAAAAATGAGGCCGG + Intergenic
1170451885 20:16491372-16491394 AAAAGTAATAAAAATGAGGAAGG + Intronic
1172260026 20:33556024-33556046 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1172548486 20:35780519-35780541 AAAAGAAAAAAGAATGAGCCAGG - Intronic
1172571630 20:35975295-35975317 AAAAATAAAAAAAAAGAGGCCGG - Intronic
1172663517 20:36583598-36583620 AAAAATAAAAAAAATTAGGCTGG + Intronic
1172675447 20:36667434-36667456 AAGATTAAAATAAATGAGCCAGG - Intronic
1172713939 20:36949458-36949480 AAAAAAAAAAAAAATGAGGCCGG + Intronic
1172728360 20:37064920-37064942 AAAAAAAAAAAGAAAGAGGCCGG - Intronic
1172822430 20:37749271-37749293 AATAGAAAAAAGAATGAGAGTGG - Intronic
1173206255 20:40996513-40996535 AAAAGAAAAAAGAAAGAGGAGGG + Intergenic
1173442938 20:43094380-43094402 AAAAAAAAAAAGAAAGAGGCCGG - Intronic
1173832868 20:46103389-46103411 AAGAGAAAAAAAAATTAGCCAGG - Intergenic
1173991240 20:47305236-47305258 AAGAAAAAAAAAAAAGAGGCAGG - Intronic
1174076132 20:47938525-47938547 AAGAGGATCAAGAAGGAGGCAGG - Intergenic
1174325361 20:49774480-49774502 AAGAAAAAAAAAAATGAGGCTGG + Intergenic
1174373364 20:50109355-50109377 AAGAGAAAAGAGAATGTGGTGGG + Intronic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174477246 20:50804333-50804355 GAGTGAAAAAAGCATGAGGCCGG - Intronic
1175101953 20:56585601-56585623 AAAAGAAAAAAAAAAGAGGCCGG + Intergenic
1175582005 20:60107170-60107192 AAACTTAAAAAGAATGAGGTTGG - Intergenic
1175599294 20:60259842-60259864 AAAAGTAAAGAAAATGGGGCAGG - Intergenic
1176610206 21:8875306-8875328 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1176656007 21:9589473-9589495 AGGAGCAGAAAGAATGAGGGGGG - Intergenic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1176800532 21:13424908-13424930 AAAAATACAAAGAATGAGCCAGG + Intergenic
1177023093 21:15887352-15887374 AAAAGTGAAAAGCATGAGGAAGG - Intergenic
1177291910 21:19123658-19123680 AAGAGCAAGAACAATGATGCTGG - Intergenic
1178184957 21:30208617-30208639 AAGAAAGAAAAGAAGGAGGCAGG + Intergenic
1178286470 21:31329432-31329454 AAGGGTGATAAGACTGAGGCAGG + Intronic
1178457266 21:32766954-32766976 AAGAGATAAAAGAATCAGGAAGG - Intronic
1178515963 21:33247410-33247432 AAAAGTACAAAAAATGAGCCAGG - Intronic
1178545482 21:33490087-33490109 AAAAGAAAAAAGAATGTGGCTGG - Intronic
1178743847 21:35228168-35228190 AAAAGAAACAAGAAAGAGGCCGG + Intronic
1178758719 21:35379382-35379404 AAGAGGAAAAAGGATTGGGCTGG + Intronic
1179356875 21:40668031-40668053 CAGAGTTAATAGAATGAGACTGG - Intronic
1179599210 21:42464746-42464768 AAAAATAAAAAAAATGAGACTGG + Intergenic
1179838613 21:44055272-44055294 AACAGTCAAAAACATGAGGCAGG - Intronic
1180360267 22:11884552-11884574 AATAGTAAAAAGAATAAGGTAGG + Intergenic
1180414770 22:12698682-12698704 TAGAGAGAAAAGAATAAGGCCGG + Intergenic
1180488876 22:15823159-15823181 AAGACTAGAAAGCATGAAGCAGG + Intergenic
1180500142 22:15923104-15923126 AAGACAAAAAGGTATGAGGCTGG - Intergenic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1180978669 22:19868076-19868098 GAGAGGAGAGAGAATGAGGCAGG - Intergenic
1181389770 22:22571754-22571776 AAGATTAAAAAAAATTAGTCAGG + Intergenic
1181449387 22:23008395-23008417 AAGAAAAAAAAGCAAGAGGCAGG + Intergenic
1181821310 22:25477824-25477846 TAGGGTCAATAGAATGAGGCAGG - Intergenic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182345356 22:29659927-29659949 AGGAGTAAAAAGATTTATGCTGG + Intronic
1182489627 22:30662666-30662688 AAAAAGAAAAAAAATGAGGCGGG + Exonic
1182514597 22:30847273-30847295 AAAAGAAAAAAGAATGAGCCTGG - Intronic
1182553018 22:31111582-31111604 AAAAAAAAAAAGACTGAGGCGGG + Intronic
1182860681 22:33556709-33556731 AAGAAAAAAAAAAAAGAGGCTGG + Intronic
1182867759 22:33619256-33619278 AAAAGTAAGAATAATGAGACCGG + Intronic
1183209234 22:36440369-36440391 TAGAGTAAAAAAGATGAGGTTGG + Intergenic
1183836802 22:40461037-40461059 AAAAGTAAAAATAATTAGCCAGG + Intronic
1183965707 22:41440861-41440883 AATACAAAAAAAAATGAGGCTGG - Intronic
1184054614 22:42036333-42036355 AAAAGTAAAAAAAATTAGCCGGG - Intronic
1184068183 22:42132016-42132038 AAAAAAAAAAAGAATTAGGCTGG - Intergenic
1184199179 22:42953962-42953984 AAGGTTAAAAGGCATGAGGCTGG + Intronic
1184896876 22:47414033-47414055 AAAATTTAAAAGACTGAGGCAGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185262730 22:49878836-49878858 AAAAATAAAAAAAATGAGCCGGG + Intronic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
949124973 3:436323-436345 AAGATAGAAAAGAATGATGCTGG + Intergenic
949266958 3:2169149-2169171 AAGAGTAATAATAAGGAAGCTGG - Intronic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
949456198 3:4241760-4241782 AATAGGCAAAAGAAAGAGGCAGG + Intronic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
949920033 3:8993279-8993301 AAGAGAAAAAAGGAGGAGGTAGG - Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950243022 3:11388587-11388609 AAAAGTACAAAGAATTAGCCAGG - Intronic
950403878 3:12792452-12792474 AAAAGAAAAAAGAATGAGGGTGG - Intergenic
950460181 3:13116560-13116582 AAGATGCAAAAGAATGAAGCTGG + Intergenic
951227872 3:20142237-20142259 AGGAGAAAAAAGAATGGGGAGGG - Intronic
951487020 3:23224087-23224109 CTGAGCAAAAAGAATGAAGCTGG - Intronic
951654529 3:24990716-24990738 AAGAGTAATAATGAGGAGGCAGG - Intergenic
951717793 3:25666755-25666777 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
951882284 3:27491110-27491132 ACGATTAAAAAGAATGAGTTAGG + Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
952973017 3:38666880-38666902 TTGAGCAAAAAGAATGAAGCTGG + Intergenic
953115218 3:39986259-39986281 AAGTGTAACCAGAATGAGGCTGG - Intronic
953321779 3:41979050-41979072 AAAAGAAAACAGAATGTGGCTGG - Intergenic
953501796 3:43443608-43443630 AAGAGTCAAAACAATGAGAGAGG + Intronic
953612188 3:44456254-44456276 AAAAGTACAAAAAATGAGCCAGG + Intronic
954026410 3:47786698-47786720 AAAAATAAAAAGAATTAGCCAGG + Intergenic
954171949 3:48811190-48811212 AAAATTAAAAAAAATGGGGCAGG + Intronic
954191928 3:48969167-48969189 AAAAAAAAAAAGAAAGAGGCTGG - Intronic
954365194 3:50142077-50142099 AAAAGAAAAAAGAAAGAGGAAGG - Intergenic
954469361 3:50678800-50678822 AAGAAAAAAAAAAATTAGGCAGG - Intronic
954544742 3:51423519-51423541 AAAAGAAAAAAGACTCAGGCCGG + Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955909946 3:63849742-63849764 AAAAGCAAAAACAATGAGCCAGG - Intronic
956327912 3:68073451-68073473 AAGAGGAAAAAGAAAGAGTTAGG - Intronic
957157564 3:76564975-76564997 AAGATGAAAAAGAGGGAGGCTGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957293196 3:78304389-78304411 GAGAGGAAAAAGAATGATTCAGG + Intergenic
957503257 3:81085382-81085404 AAGATAAAAAATGATGAGGCTGG - Intergenic
957573169 3:81975052-81975074 AAGAGAAAAAAAAATAAGGATGG - Intergenic
957843875 3:85705160-85705182 AAGAATGAAAAGAAGGGGGCGGG - Intronic
958517033 3:95130116-95130138 AAAAATAAAAAAAATGAGCCTGG + Intergenic
958746122 3:98136961-98136983 AACACTAAATGGAATGAGGCAGG + Intergenic
958813305 3:98888256-98888278 GAGCTTAAAAAGAATGAAGCTGG - Intronic
958939973 3:100300660-100300682 AAAAGTAAAAAAAATTAGCCAGG - Intronic
959434274 3:106294840-106294862 AAGAGAAAAAAGAAAGATGTGGG - Intergenic
959586537 3:108030503-108030525 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
959749229 3:109813378-109813400 AAGGGTGAAAAGCATGAGACTGG + Intergenic
960089015 3:113620269-113620291 AAGAGGAAGAAGAATGATGTAGG - Intronic
961226577 3:125255094-125255116 AATAGCAAAAATAGTGAGGCGGG - Intronic
961395259 3:126582814-126582836 AAGTGGAAAAAGAATGAGTTTGG + Intronic
961538005 3:127581614-127581636 AAAAGTAAAAAAGATGTGGCCGG + Intronic
961737543 3:129011556-129011578 AAAAAAAAAAAGAATGAAGCAGG + Intronic
962095446 3:132287968-132287990 AAGTGTAAAAACCCTGAGGCAGG - Intergenic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
963093743 3:141512764-141512786 AAAAGTCAAAATAAGGAGGCCGG + Intronic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963224152 3:142844051-142844073 AATAATAAAAACAATGAAGCAGG - Intronic
963710888 3:148746378-148746400 AAGAGAAAATAGATTGAAGCAGG + Intergenic
963802480 3:149689954-149689976 AGGAGTTAAAAGTAAGAGGCAGG + Intronic
963855401 3:150248179-150248201 AAGAGCAAAAGGAATGAACCAGG - Intergenic
964272859 3:154977416-154977438 AAAAAAAAAAAGAATCAGGCCGG + Intergenic
964348533 3:155779720-155779742 AAGAGTTAAAAGAAGTAGGATGG + Intronic
964941426 3:162160660-162160682 AAATTAAAAAAGAATGAGGCGGG - Intergenic
965395876 3:168160078-168160100 AAGTCTTAAAAGAAAGAGGCAGG + Intergenic
965586583 3:170324497-170324519 GAAAGCAAAAAGAATGAAGCTGG + Intergenic
965780844 3:172284502-172284524 AAGAGTGACAGAAATGAGGCTGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966537282 3:181049042-181049064 AAAAGTAAAAAAAATTAGCCGGG - Intergenic
966542156 3:181103885-181103907 CAGAGTGGAAAGAGTGAGGCAGG + Intergenic
966820484 3:183920493-183920515 AACAGCAAAAAGAAGAAGGCAGG + Exonic
966852698 3:184174606-184174628 AAAAAAAAAAAAAATGAGGCGGG + Intronic
967202893 3:187089601-187089623 CTGAGTAAAAAGAATGAAGCTGG - Intergenic
967223966 3:187273912-187273934 AAGAGTAATAATAATCAGCCAGG + Intronic
967292743 3:187937069-187937091 TAGAGTAAAAATAAAGAGGGAGG - Intergenic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967538898 3:190641604-190641626 AGTAGTAAAATGAATGAGGCAGG + Intronic
967799511 3:193640571-193640593 AAGAGATTAAAGACTGAGGCAGG + Intronic
967906855 3:194508515-194508537 AAGAGGCAAAAGAATTAGGCAGG + Intergenic
968174867 3:196540687-196540709 AAAAGAAAAAAGAAAAAGGCCGG + Intergenic
1202736888 3_GL000221v1_random:10092-10114 AATAGTAAAAAGAATGAGGTAGG + Intergenic
968438018 4:605189-605211 AAAAGTACAAAAAATTAGGCGGG - Intergenic
968686739 4:1964727-1964749 AAGAGAAAAATGAAAGAGGGGGG - Intronic
968715229 4:2153160-2153182 GAGAGCAAAAAGCAAGAGGCAGG + Intronic
968768433 4:2487578-2487600 AAAAATTAAAATAATGAGGCTGG - Intronic
969541897 4:7796899-7796921 AAAAGTAAAAAAAATTAGCCAGG + Intronic
969663619 4:8544645-8544667 AAGAATAGAAGGAGTGAGGCCGG + Intergenic
969929115 4:10613151-10613173 AACAGTAAACAGAATGAATCAGG + Intronic
970353682 4:15231644-15231666 TAGGGTAAAATGAATTAGGCTGG - Intergenic
970397416 4:15682472-15682494 AAAAGGAAAGAGAATGAGACGGG - Intronic
970793154 4:19882950-19882972 AAGATTTAACAAAATGAGGCTGG + Intergenic
970936513 4:21577468-21577490 AAAAGTACAAAAAATTAGGCAGG + Intronic
971007802 4:22394640-22394662 AAAGGTCAAAAGAATGAGGTAGG + Intronic
971024270 4:22572546-22572568 AAGAATATAAAGTAGGAGGCCGG - Intergenic
971574595 4:28256933-28256955 AAAAATAAAAAAAATTAGGCCGG + Intergenic
971645075 4:29189019-29189041 AAAAGTAAAAAGAAGGGAGCCGG - Intergenic
971704805 4:30026853-30026875 AATAGTGAAAAAAATGAGGAAGG - Intergenic
972422728 4:38904817-38904839 AAGAGTAAAGAGGATGAGACAGG + Intronic
972505444 4:39716406-39716428 AAAAGTAAAAAAAATCAGCCAGG - Intronic
972527194 4:39926223-39926245 AAAAATAAAAAGATAGAGGCCGG + Intronic
972908001 4:43774960-43774982 AAGATTAAAAAAATTGAGGGTGG - Intergenic
972975852 4:44635028-44635050 AAAAGAAAGAAGAATGTGGCTGG + Intronic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973266332 4:48214854-48214876 AAAAATAAAAATAATTAGGCCGG + Intronic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
973385188 4:49507822-49507844 AATAGTAAAAAGAATGAGGTAGG - Intergenic
973656712 4:53055658-53055680 GAGAGAAAAAAGAATGAAACAGG + Intronic
974137067 4:57832223-57832245 AATAGTAAAAAGGAGGAGGCAGG - Intergenic
974512232 4:62858019-62858041 AAAAGTACAAAAAATGAGCCGGG - Intergenic
975178889 4:71320456-71320478 AAATGTATAAAGAATGAGTCAGG - Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
976711168 4:88073052-88073074 AAGAGTAGGAACATTGAGGCTGG + Intronic
977073171 4:92418618-92418640 ATGAGTAAAAAGATAGAGGCGGG + Intronic
977473891 4:97478743-97478765 ATGACTAAAAAAAATGAGGAAGG + Intronic
977569767 4:98616982-98617004 AAAAATAAAAAGAATTAGCCAGG - Intronic
977605020 4:98975532-98975554 ATGAGTAAAAAGAACAAAGCTGG - Intergenic
977733679 4:100384401-100384423 ATGAATAAAATGAATGAGACAGG + Intergenic
977862851 4:101987065-101987087 TAGAGACAAAAGTATGAGGCTGG + Intronic
978088331 4:104683352-104683374 AAAACTAGAAAGAATGAGGAAGG + Intergenic
978177424 4:105750165-105750187 AAAAGTAACAACACTGAGGCCGG + Intronic
978221487 4:106280865-106280887 ATGAGCAAAAAGAATGAAACTGG - Intronic
978481546 4:109197163-109197185 AAAAATAAAAAGAATTAGCCAGG + Intronic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
978922575 4:114201958-114201980 AAGAGTATAAGAAATGTGGCAGG - Intergenic
979013993 4:115408552-115408574 AAGAAAAAAAAGAATGAGAGTGG - Intergenic
979157997 4:117422340-117422362 AAGAGAAAAAAAAATGTGGCAGG + Intergenic
979241365 4:118449663-118449685 AAAAGAAAAAAGAATTAGCCAGG - Intergenic
979476847 4:121168493-121168515 AAAAGAAAAAAGAAAAAGGCTGG - Intronic
979763867 4:124440873-124440895 ATGAGCAAAAAGAATAAGGCTGG - Intergenic
979808496 4:125005180-125005202 AAAAATACAAAGAATGAGGCAGG - Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
980581468 4:134759490-134759512 AAGAGTAAAAACTAAGAGGTAGG + Intergenic
980583830 4:134787958-134787980 AAAGAAAAAAAGAATGAGGCTGG - Intergenic
980635417 4:135495696-135495718 CAGAGTAAAAAGAATTAGTGGGG + Intergenic
980790030 4:137608490-137608512 AAGAGTAACAAAAATTAGCCTGG - Intergenic
980903216 4:138924626-138924648 AAAAGAAAAAAGAAGGAGGTGGG + Intergenic
981102761 4:140848484-140848506 AAGAAGGAAAAGAATAAGGCAGG - Intergenic
981206454 4:142046594-142046616 TAGAGTGAAAAGAAAGAGGAGGG + Intronic
982031825 4:151308857-151308879 AAAAGAAAAAAGAAAGACGCAGG - Intronic
982132322 4:152240983-152241005 AAGAGAAAAAAAAATGAAGGGGG + Intergenic
982530793 4:156540722-156540744 AAGAGTTAAAAATATGAAGCTGG + Intergenic
983008071 4:162510033-162510055 AAGAGTGAAAGCAATAAGGCTGG - Intergenic
983462500 4:168046039-168046061 AAGTGTAAAAAGGATAAAGCTGG - Intergenic
984205424 4:176782169-176782191 AAGAGAAAAAGAAATTAGGCTGG + Intronic
984300169 4:177906471-177906493 AAGTGTCCAAAGAATAAGGCAGG + Intronic
984589879 4:181605292-181605314 AAGAAAAAAAAGAATTAGCCGGG + Intergenic
984605180 4:181777351-181777373 CTGAGCAAAAAGAATGAAGCTGG - Intergenic
984646550 4:182226239-182226261 AAGAGAAAAAAAGAAGAGGCTGG + Intronic
984859402 4:184223496-184223518 TTGAATAAAAAGAATGAAGCTGG + Intergenic
985006214 4:185537414-185537436 AAGAAAAAAACAAATGAGGCCGG - Intergenic
985125626 4:186691645-186691667 AAAAGTAAAAAAAATTAGCCGGG + Intronic
985266707 4:188157897-188157919 AAAAATAAAAAGAATGAGCCAGG + Intergenic
1202769050 4_GL000008v2_random:183180-183202 AATAGTAAAAAGAATGAGGTAGG - Intergenic
986118309 5:4803041-4803063 AAGAGAGAAAAGAAAGAGGAAGG + Intergenic
987008561 5:13736553-13736575 AAGAGAAAAAAAAATTAGCCAGG - Intronic
987317421 5:16736740-16736762 AAGAAGAAAAAGAATGTGGTAGG + Intronic
987453761 5:18118906-18118928 AAGAGGAAAAAGAGTGATGGAGG - Intergenic
987683388 5:21165976-21165998 TATAGTATAAAGAACGAGGCCGG + Intergenic
987823957 5:23004096-23004118 AAGAGAAAAGGGCATGAGGCAGG - Intergenic
988042517 5:25908206-25908228 AAGAATCAAAACACTGAGGCAGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988263458 5:28921281-28921303 AAAAGTAAAAGGAAAGAGGTAGG + Intergenic
988907230 5:35802151-35802173 AAGAGTAAAGACAGAGAGGCAGG - Intronic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989151465 5:38303975-38303997 AAAAGTAAAAAAAATTAGCCAGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989437306 5:41429733-41429755 AAGAGAAAAAGGAATGACGAAGG + Intronic
989531713 5:42515026-42515048 AAGACTATAAAGCATGATGCAGG + Intronic
989580649 5:43030081-43030103 AAAAGAAAAAAGATTTAGGCTGG - Intergenic
989580781 5:43031178-43031200 AACAGTAAAAAAAATGAGCCAGG + Intergenic
989783115 5:45293934-45293956 AAGAGGATAACGAATGAGGAAGG + Intronic
990171278 5:53052755-53052777 AAGAGGCAAAAGAATTTGGCAGG - Intronic
990251968 5:53925354-53925376 AATAGTAAAAAAAATTAGCCAGG - Intronic
990446326 5:55897144-55897166 AACAGTATAAAGAAACAGGCTGG - Intronic
990894156 5:60679562-60679584 AAGAAAAAAAGGAATGAGACAGG + Intronic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
991353259 5:65741209-65741231 TTGAGTAAAAAGAATAAAGCTGG - Intronic
991541385 5:67733569-67733591 AAGAGTATAATACATGAGGCTGG + Intergenic
992036006 5:72776952-72776974 AGAATTAAAAAGAATGAGGAAGG + Intergenic
992116923 5:73547361-73547383 AAGACTAAAAAAAATTAGCCAGG - Intergenic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
992899835 5:81283048-81283070 AAGAATAAAAAGAATGAAGGAGG - Intergenic
993316098 5:86408032-86408054 AAGAAGAAAAAGAATAAGGTGGG + Intergenic
993542412 5:89168528-89168550 AAGATTTAGAAGAATTAGGCTGG - Intergenic
993820764 5:92613510-92613532 TAGAATAAAAAGAATGAGTGGGG + Intergenic
994456771 5:100019181-100019203 AGGAATCAAAAGAATTAGGCTGG - Intergenic
994912764 5:105933941-105933963 ATGAGTAAAAAGAAGCAGGTGGG + Intergenic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
996113388 5:119591697-119591719 AAAAGCCAAATGAATGAGGCTGG + Intronic
996138232 5:119871775-119871797 AAGTGTAAGAATAATGATGCTGG - Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996920300 5:128760603-128760625 AAAAAAAAAAAGAATAAGGCCGG + Intronic
997519722 5:134515076-134515098 AATAATAAAAAGTATGGGGCTGG - Intergenic
997769079 5:136536373-136536395 AATAGTAGAAAGGAGGAGGCAGG - Intergenic
997982880 5:138480589-138480611 AAGAAAGAAAAGAAAGAGGCCGG - Intergenic
998050840 5:139033152-139033174 AAAAGTAAAAAAAATGAGCCAGG - Intronic
998206238 5:140158527-140158549 AAAAAAAAAAAAAATGAGGCAGG + Intergenic
998209051 5:140179957-140179979 AAGAAAAAAGAGAGTGAGGCTGG - Intronic
998304439 5:141060036-141060058 AAAATTAAAAAAAATGCGGCTGG + Intergenic
998898235 5:146823356-146823378 AAAAATAAAAAAAATTAGGCGGG - Intronic
998949128 5:147374125-147374147 AAAAGAAAAAAAAATTAGGCAGG + Intronic
999022371 5:148181703-148181725 CTGAGCAAAAAGAATGAAGCTGG - Intergenic
999127452 5:149256437-149256459 AATAGTACAAAGAAAGAGGCAGG + Intronic
999528828 5:152438971-152438993 AAGAGTTAAAAAACTGGGGCTGG + Intergenic
999585275 5:153082780-153082802 AAAAGTAAAGAGAATGAGACTGG + Intergenic
999594787 5:153190976-153190998 AAGATTAAGAAGAATGAGAAGGG - Intergenic
999778883 5:154833195-154833217 AAAAGTACAAAAAATGAGCCAGG - Intronic
999874013 5:155782319-155782341 AAGAAAAATAAAAATGAGGCCGG - Intergenic
1000401751 5:160836085-160836107 TAGATTCAAAAGAATGAGGAGGG + Intronic
1000437161 5:161226400-161226422 AGCATTAAAAAGAATGAGGGTGG + Intergenic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001807907 5:174604209-174604231 AAAAGTACAAAAAATTAGGCGGG + Intergenic
1002038868 5:176495910-176495932 AAGAGAAAAAAAAATGATGATGG + Intronic
1002240743 5:177837636-177837658 AGGGGTAAAGAGAATGAGACAGG - Intergenic
1002255288 5:177953862-177953884 AAGAGTAAAAAGATGGGGCCGGG + Intergenic
1003442764 6:6159060-6159082 AAAAGTACAAAAAATTAGGCAGG - Intronic
1003578751 6:7320585-7320607 AAAAATACAAAAAATGAGGCAGG - Intronic
1003750458 6:9049336-9049358 AATATTAAAAATAATGAGGTCGG - Intergenic
1004242426 6:13936909-13936931 GAGAGTAAAAAGAATTGGGGAGG + Intronic
1004649185 6:17592135-17592157 AAGAATCAAAAGAATGAGAGAGG + Intergenic
1004955661 6:20725131-20725153 AAGAGAGAAAAGAAAAAGGCGGG - Intronic
1005104697 6:22211728-22211750 AAGAGTTAAAAGAATTTGGGGGG - Intergenic
1005547091 6:26882901-26882923 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
1005711612 6:28508507-28508529 AAAAATAAAAAAATTGAGGCCGG + Intronic
1005765265 6:29005267-29005289 AAGAATAAAAAGAATGGGTCAGG + Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006048487 6:31320030-31320052 TAGAATAAAAAGAATCTGGCTGG - Intronic
1006315664 6:33290027-33290049 AAGAGTACTGAGACTGAGGCGGG - Intronic
1006488434 6:34364858-34364880 AAAAATAAAAAGAATTAGCCGGG + Intronic
1006614320 6:35315391-35315413 CTGAGTAAAAAGAACGAAGCTGG - Intronic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006774720 6:36583339-36583361 AAAAAAAAAAAAAATGAGGCGGG + Intergenic
1006776462 6:36596547-36596569 AGGAGTAAAGATAATGGGGCGGG + Intronic
1007266813 6:40602529-40602551 AATGGGAAAAAGAAAGAGGCAGG - Intergenic
1007285733 6:40746207-40746229 GAGAGTCAAAACAACGAGGCAGG + Intergenic
1008304143 6:49880496-49880518 CTGAGTAAAAAGAATGAAACTGG - Intergenic
1008601889 6:53104486-53104508 AAGAGCAAAAACAAAAAGGCTGG - Intergenic
1008902582 6:56638505-56638527 CAGAGGAAAAAAAATGATGCTGG - Intronic
1009017853 6:57923975-57923997 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
1009295999 6:61948478-61948500 AAGAATCAAAAGAATGAGTTTGG + Intronic
1009372211 6:62919646-62919668 GAGAATAGAAAGAATGAGGCAGG - Intergenic
1009930363 6:70170411-70170433 AAGATTAGAAATAGTGAGGCAGG - Intronic
1009950252 6:70387147-70387169 AAGAGCAAAAAGAAGCAGGGAGG - Intergenic
1010199416 6:73269525-73269547 AAGCATAAAAAGATTCAGGCTGG - Intronic
1010251871 6:73715402-73715424 AAAAGTAAAAAAAATTAGCCAGG + Intronic
1010535610 6:77025778-77025800 AAGAGCAAATAGATAGAGGCAGG - Intergenic
1010680454 6:78793013-78793035 AAAAGTAAAAACAATTAGCCAGG - Intergenic
1010816251 6:80361131-80361153 CAGAGAGAAAAGAATGAAGCTGG - Intergenic
1010839078 6:80626144-80626166 AACATTAAAAAAATTGAGGCTGG + Intergenic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011466767 6:87666424-87666446 AAAAAAAAAAAGAATTAGGCCGG - Intronic
1011532712 6:88341376-88341398 AAGAGCATAAACAATGGGGCGGG + Intergenic
1011636844 6:89382577-89382599 AAAATTAAATAAAATGAGGCCGG + Intronic
1011714055 6:90085683-90085705 AAGGGTAACAGGAATGAGGGAGG + Intronic
1011763934 6:90598649-90598671 AAAAGTAAAAAAATTGAGGCAGG + Intergenic
1011775262 6:90722840-90722862 AACAGTAAAAAGCATTAGGTTGG + Intergenic
1011988241 6:93477659-93477681 AAGAGTAAAAATAAAGATGCAGG + Intergenic
1012536118 6:100299179-100299201 AAGACAGAAATGAATGAGGCTGG + Intergenic
1013121837 6:107148263-107148285 AAGATTAAAAAAAATTAGCCAGG + Intergenic
1013131104 6:107233650-107233672 AAAATTAAAAAAAATTAGGCAGG + Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013854443 6:114554970-114554992 CTAAGTAAAAAGAATGAAGCTGG + Intergenic
1013925467 6:115466968-115466990 AAAAGAAAAAACAATGAAGCAGG - Intergenic
1014056743 6:117024814-117024836 GAGAGGAAAAGGAGTGAGGCTGG + Intergenic
1014148246 6:118022909-118022931 AAGAAAAAAAAGAATTAGCCCGG - Intronic
1014488880 6:122037149-122037171 AGGAGTAATAAGAATGAGATGGG - Intergenic
1014948005 6:127519013-127519035 AAGAGGAAAGAGAAGAAGGCGGG + Exonic
1014952051 6:127567890-127567912 CAGAGATAAAAGAATGGGGCAGG + Intronic
1014952966 6:127580446-127580468 AAGAGTATAAAGAAGGAACCTGG - Exonic
1014989959 6:128062364-128062386 AAAACTAAAAAAAATGAGCCAGG - Intronic
1015261772 6:131246253-131246275 AAAACTAAAAAGTATGAGGTGGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1016133210 6:140503231-140503253 CAGAGTAAATAGAAAGAGGTGGG + Intergenic
1016227974 6:141763941-141763963 AACAGTAAAAAGAATTATGAGGG - Intergenic
1016796659 6:148125234-148125256 AAGAATAAAAAAAATTAGCCGGG + Intergenic
1017089162 6:150743221-150743243 AAAAATAAAAAGGAAGAGGCTGG + Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017617550 6:156261211-156261233 AAAAGTAAACAGAATTAGACTGG + Intergenic
1017731085 6:157316713-157316735 AAAAATAAAAAAAATGAGCCAGG + Intronic
1017827309 6:158091443-158091465 AAAAAAAAAAAGAATGGGGCTGG + Intronic
1018089890 6:160337099-160337121 AAAAGAAAAAAGAAAAAGGCTGG + Intergenic
1018302905 6:162422646-162422668 AAGAGTCATAAGAAGGAGGCTGG + Intronic
1019029472 6:168997897-168997919 AAGAATAAAAAAAATTAGCCAGG - Intergenic
1019775049 7:2907333-2907355 AAAAATAAAAAGGATGTGGCCGG - Intronic
1019984171 7:4642886-4642908 AAGACTAAAAAGCAAGTGGCAGG + Intergenic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020121455 7:5506238-5506260 AAAAGAAAAAAAAAAGAGGCCGG - Intronic
1020236096 7:6356709-6356731 AAGAAAAAAAACAATTAGGCTGG + Intergenic
1020903914 7:14041277-14041299 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
1021167176 7:17355582-17355604 AAGAAAAAATAGAATGAGCCTGG + Intergenic
1021226445 7:18033581-18033603 TAAAATAAAAAGAATGAGGGTGG - Intergenic
1021729362 7:23581430-23581452 AAAATTAAAAAGAATTAGCCAGG + Intergenic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1022013314 7:26328021-26328043 AACAAGAAAAAGAATGTGGCCGG - Intronic
1022157075 7:27671427-27671449 AAGCATAGAAAGAAAGAGGCAGG + Intergenic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023376032 7:39556479-39556501 ATGATTAAAAAAAATAAGGCAGG + Intergenic
1023583942 7:41709446-41709468 AAGAGTATAATGAATGAGGGAGG + Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023831704 7:44042316-44042338 AAAAAAAAAAAGAATGAGTCTGG + Intergenic
1023944635 7:44793955-44793977 AAGAAGTAAATGAATGAGGCCGG - Intergenic
1024365665 7:48517561-48517583 AGGAGTGAAAGGAATGTGGCAGG - Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024737171 7:52318206-52318228 AAGAGAAAAAAAAATGAAGCAGG - Intergenic
1024933072 7:54685070-54685092 AAGAGTAAAATGATAGATGCTGG + Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1024997676 7:55285950-55285972 TAAAGGAAACAGAATGAGGCAGG + Intergenic
1025113109 7:56235880-56235902 AAAAGAAAAAAAAATGAGGCAGG + Intergenic
1025183575 7:56838358-56838380 AATAATAAAAAAAATGAGCCAGG - Intergenic
1025216101 7:57057913-57057935 AAAAGAAAAAAAAAAGAGGCTGG + Intergenic
1025264918 7:57448956-57448978 AAAAGTAAAAAGAAAAAGGTGGG - Intergenic
1025282694 7:57639651-57639673 AGGAGCAGAAAGAATGAGGGGGG - Intergenic
1025302023 7:57825766-57825788 AGGAGCAGAAAGAATGAGGGGGG + Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1025655279 7:63512790-63512812 AAAAGAAAAAAAAAAGAGGCTGG - Intergenic
1025742073 7:64205919-64205941 AAAAGTAAAAAGAAAAAGGTGGG - Intronic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1026579144 7:71599487-71599509 AAGAGGACACAGAATGATGCGGG - Intronic
1026677272 7:72438273-72438295 AAAAATAAAAATAATGAGCCAGG - Intronic
1027050941 7:75020783-75020805 AAAAATAAAAAAAATCAGGCTGG - Intronic
1027510545 7:79073902-79073924 AAGATTAATAAGAATAAGACTGG - Intronic
1027579223 7:79972726-79972748 AAGAGGAAGAAGCATCAGGCAGG - Intergenic
1027611861 7:80371032-80371054 GAAAGTAAAAAGAATGAGAAAGG + Intronic
1027651824 7:80878079-80878101 TAGAATAAAAAAAATGAGGCCGG + Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1028393098 7:90337532-90337554 AAAATTAAAAATAATGAGTCAGG - Intronic
1028543952 7:91977097-91977119 AAAAGTAAAAAAAATTAGCCGGG + Intronic
1029296487 7:99544169-99544191 AAAAATAAAAACTATGAGGCAGG + Intergenic
1029408236 7:100390697-100390719 AAGAAGAAAAAGAATTAGCCTGG + Intronic
1029428172 7:100510541-100510563 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029634135 7:101772729-101772751 AAGAGAAGAAAGAAAGAGGGAGG + Intergenic
1029915227 7:104201927-104201949 AAAAGTAAAAAAAATTAGACAGG + Intronic
1029958642 7:104666819-104666841 ATTAAAAAAAAGAATGAGGCTGG - Intronic
1030888493 7:114968111-114968133 AAGATTAACACGATTGAGGCTGG - Intronic
1031519283 7:122743620-122743642 AAGAGTAATAAAAATGAGAAAGG + Intronic
1031834546 7:126667649-126667671 AAAAGGAAAAAGAATGATGTAGG + Intronic
1032016710 7:128384622-128384644 AAAAATAGAAAGAATGAGGCTGG + Intergenic
1032033350 7:128502970-128502992 AAGAATTAAAAGAATTTGGCTGG + Intronic
1032063676 7:128747061-128747083 AAGGTTAAAAAGAATGGGCCGGG - Intronic
1032282500 7:130515745-130515767 AAGGGATAAATGAATGAGGCTGG + Intronic
1032374767 7:131401569-131401591 AACAGAAAAAAGAAAGAAGCAGG - Intronic
1032562453 7:132906614-132906636 AAAAGGAAAAAGATTGGGGCGGG - Intronic
1032667360 7:134049971-134049993 ACCATTAAGAAGAATGAGGCAGG + Intronic
1032932768 7:136693383-136693405 AAGAGAAATAACAATGATGCTGG - Intergenic
1033004596 7:137548004-137548026 AAGAGCAAAGAGAATGAAGAAGG + Intronic
1033206555 7:139428097-139428119 AAGACTGAAATGAATGAAGCAGG + Intergenic
1033320298 7:140333117-140333139 AAGACTAAAAATAATTAGCCAGG + Intronic
1033321094 7:140340282-140340304 AAAAAAAAAAAGAATGAGGTTGG - Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1033850571 7:145489338-145489360 AAGAAGAACAAGATTGAGGCAGG - Intergenic
1034315067 7:150123253-150123275 ACAAAAAAAAAGAATGAGGCTGG + Intergenic
1034384207 7:150725097-150725119 AAAAGAAAAAATAATGAGCCGGG + Intronic
1036437261 8:8746009-8746031 AAAAGTAAAGTGAAAGAGGCTGG + Intergenic
1037170432 8:15885657-15885679 AAGAGAAAAAAAAATTAGCCGGG + Intergenic
1037274464 8:17162844-17162866 AAAAGGATAAACAATGAGGCAGG + Intronic
1037331106 8:17744571-17744593 AAAAGTAAAAAGATTGATGGTGG - Intronic
1037703937 8:21299435-21299457 AAAAGTACAAAAAATGAGCCTGG + Intergenic
1037711503 8:21358978-21359000 AAAAATAAAAAAAATGAGCCAGG - Intergenic
1037714915 8:21389148-21389170 AAAAATAAAAAGAATGAGGGGGG - Intergenic
1038186206 8:25277427-25277449 AACAGTAAAAAAAAAGAGGAAGG + Intronic
1038822280 8:30963839-30963861 AAAAAAAAAAAGAATGAGCCTGG - Intergenic
1039055541 8:33533404-33533426 AAAAAAAAAAAGAATGAGCCGGG - Intergenic
1039254184 8:35700951-35700973 AAGAGTACAAAGAATGTGAAGGG + Intronic
1039294914 8:36140154-36140176 AAGAGTTAAGAGCATGAGTCTGG + Intergenic
1039331654 8:36543827-36543849 ATGAGCAAAAAGAACAAGGCTGG + Intergenic
1039472070 8:37819664-37819686 AAAAGAAAAAAGAAAAAGGCCGG - Intronic
1039553714 8:38461603-38461625 AAGAATAAAAAGACCCAGGCTGG - Intronic
1039615669 8:38953135-38953157 AAGAGAAAAAAAAATCTGGCTGG - Intronic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1041217109 8:55611637-55611659 AAAAGTATAAAAAATGAGCCGGG - Intergenic
1041299426 8:56395259-56395281 AAGAAGAAAAAGAATGTTGCTGG - Intergenic
1041599702 8:59701922-59701944 AAAAGAAAAAAAAATGAGCCGGG - Intergenic
1042056675 8:64771354-64771376 ATTTTTAAAAAGAATGAGGCTGG - Intronic
1042108981 8:65358951-65358973 AAAATTCAAAAGAATGAGGTGGG - Intergenic
1042552454 8:70006093-70006115 AAAAGTACAAAGAACTAGGCCGG - Intergenic
1042626875 8:70767795-70767817 AAAAGACAAAAGAATCAGGCTGG - Intronic
1042967401 8:74369591-74369613 AAGAGAACAAAGAATGGGGCAGG + Intronic
1043088218 8:75864606-75864628 AAGAGTAAATAGATGTAGGCTGG + Intergenic
1043170879 8:76965044-76965066 AAAAGGAAAAAGGATCAGGCTGG - Intergenic
1043373417 8:79620015-79620037 AAGATTCAAAAGGATGAAGCAGG - Intronic
1043407868 8:79957154-79957176 AAGAAAAAACAGAATGTGGCAGG - Intronic
1043594328 8:81866239-81866261 AAAAATAAAAAGAATTAGCCAGG - Intergenic
1043759992 8:84056292-84056314 AGGAGTAAAAAGAATATGGCTGG - Intergenic
1043882501 8:85561340-85561362 AAAAGTAAAAAGAAACAGGTAGG - Intergenic
1044006252 8:86940460-86940482 AAAATTAAAAGGAATGGGGCCGG - Intronic
1044674194 8:94713244-94713266 AAGAGTACAAAAAATTAGCCAGG - Intergenic
1044868893 8:96599100-96599122 AAAAATAAAAAGAATTAGCCAGG - Intronic
1044994295 8:97823999-97824021 AACAATAAAAATAATGGGGCGGG - Intronic
1045040650 8:98220702-98220724 ATCAATAAAAAGAATTAGGCTGG - Intronic
1045119012 8:99015106-99015128 AAGAGGAAAAAGAAGCAGCCAGG - Intronic
1045150775 8:99405168-99405190 AAGAGAAAAAAAAATAAGACTGG - Intronic
1045234798 8:100341887-100341909 AAGAGTAAAAGGATTGGTGCGGG + Intronic
1045240528 8:100396679-100396701 TTGAGTTAAAAGAATAAGGCTGG + Intronic
1045491640 8:102674701-102674723 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
1045669956 8:104539779-104539801 AAGATAAAAAAAAATGAGGGAGG + Intronic
1045890082 8:107145699-107145721 GAGAGTGGGAAGAATGAGGCAGG + Intergenic
1046259933 8:111754675-111754697 ATGAGTGACAGGAATGAGGCTGG - Intergenic
1046648660 8:116813018-116813040 AAAAATAAAAAAAATGAGGCTGG + Intronic
1046801289 8:118430666-118430688 AAGAGTGAAAAGAATAAAGACGG - Intronic
1047037318 8:120954267-120954289 AGGAGTAAAAAGAGTCAGTCAGG - Intergenic
1047521497 8:125598634-125598656 GACAGTGAAAAGAATGAGACAGG - Intergenic
1047845111 8:128797201-128797223 AGGAGTAAAAAAACTGAGGCAGG + Intergenic
1048497197 8:134945216-134945238 ACGAGGCCAAAGAATGAGGCAGG - Intergenic
1048599007 8:135898778-135898800 AAAAGTAAAAAAAATTAGCCAGG - Intergenic
1049110812 8:140641878-140641900 AAATTTAAATAGAATGAGGCTGG + Intergenic
1049558452 8:143295575-143295597 AAAACTAAAAAAAACGAGGCGGG + Intronic
1049586249 8:143433750-143433772 AATAGTAAGTAAAATGAGGCCGG + Intergenic
1049836928 8:144742008-144742030 CAGAGTAAAAACCAAGAGGCCGG + Intronic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050182492 9:2935378-2935400 GGGAGAAAGAAGAATGAGGCAGG - Intergenic
1050193719 9:3057686-3057708 AAAAATTAAAAGAATGAGACTGG - Intergenic
1050349988 9:4732108-4732130 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1050548859 9:6732063-6732085 AATAGATCAAAGAATGAGGCTGG + Intronic
1050548912 9:6732391-6732413 AAAAAAAAAAAGAATGAGGCCGG + Intronic
1050566168 9:6886471-6886493 AAGAAAAAAAAAAATTAGGCGGG - Intronic
1050574970 9:6985332-6985354 AAGAGCAAAGGCAATGAGGCTGG - Intronic
1050891816 9:10834152-10834174 AAGGTAAAAAATAATGAGGCAGG - Intergenic
1050911836 9:11080981-11081003 AAAAGTAAAAAAAATTAGCCGGG + Intergenic
1051173485 9:14342497-14342519 AAGAGAAAAAAGAAATAGGGAGG + Intronic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051302146 9:15663455-15663477 AAGAATAAAAATAAGCAGGCAGG - Intronic
1051624403 9:19084922-19084944 AAAAGAAAAAAAAAAGAGGCGGG - Intronic
1052079375 9:24185012-24185034 AAGAGTAAAAAGACAGTGACAGG - Intergenic
1052174769 9:25445091-25445113 AAAAGTGAAAAGAATCAGACAGG + Intergenic
1052255868 9:26455846-26455868 AAGAGGAAAAAAAAAAAGGCAGG - Intergenic
1052721824 9:32180854-32180876 AATAGTACACAGAATGAGGCTGG + Intergenic
1052933522 9:34074970-34074992 TAAAAAAAAAAGAATGAGGCTGG - Intergenic
1052933572 9:34075293-34075315 AAAAAAAGAAAGAATGAGGCTGG - Intergenic
1052965580 9:34338194-34338216 AAGACTAAAAAAAATCAGACTGG + Intronic
1053146212 9:35713844-35713866 AAGAGAAAAAAGAAAAAGGAAGG + Intronic
1053571167 9:39309319-39309341 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1053837057 9:42149932-42149954 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1053894951 9:42733616-42733638 AATAGAAAAAAAAATTAGGCGGG - Intergenic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1054092733 9:60868022-60868044 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1054114204 9:61143928-61143950 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1054125978 9:61309693-61309715 AAAAGTAAAAAGAACAAAGCTGG - Intergenic
1054360655 9:64112465-64112487 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1054593548 9:67038584-67038606 AAAAGTAAAAAGAACAAAGCTGG - Intergenic
1054766110 9:69043878-69043900 AAAAATAAAAAACATGAGGCCGG - Intronic
1054777227 9:69133845-69133867 AAGAGCCAGAAAAATGAGGCTGG - Intronic
1054853030 9:69868372-69868394 AAAAGAAACAAAAATGAGGCTGG + Intronic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055392068 9:75833653-75833675 AAGAATAAAGTGGATGAGGCTGG - Intergenic
1055457497 9:76486777-76486799 AAGAGAAGAAAGAATAGGGCTGG + Intronic
1055557906 9:77494079-77494101 AAGATTAAAAAAAATTAGCCGGG - Intronic
1055565854 9:77568027-77568049 AAGACTAGAAAGAAAGAGGTGGG + Intronic
1055910727 9:81347792-81347814 GATAGAAAATAGAATGAGGCTGG - Intergenic
1055927133 9:81522219-81522241 AAAAGTCAAAAGAATTAGCCAGG - Intergenic
1056498467 9:87184582-87184604 GAGAATAGAAAGCATGAGGCAGG - Intergenic
1056558700 9:87711021-87711043 AAGAATAAAAAGATGGAGGCGGG + Intergenic
1056621885 9:88221528-88221550 AAGAGTGAAAAGAATGGGAAGGG - Intergenic
1056721119 9:89072972-89072994 AAGTGAATAGAGAATGAGGCTGG + Intronic
1057699599 9:97354156-97354178 AAAAGTAAAAAAAATTAGCCAGG - Intronic
1058065345 9:100542845-100542867 AGGAGTTAAGAAAATGAGGCAGG - Intronic
1058201114 9:102041873-102041895 AAGAATGAAAAGAATGAAACTGG + Intergenic
1058535603 9:105956848-105956870 AAGAGTAAAGAGGATGTGGGAGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058913822 9:109545967-109545989 AAAAGTAAAAAAAATTAGCCAGG + Intergenic
1059044098 9:110845428-110845450 AAGAGGAAAAAGAACCAGACAGG + Intergenic
1059319719 9:113459740-113459762 AAAAATAAAAAAAAAGAGGCCGG + Intronic
1059982102 9:119784357-119784379 ATTATTATAAAGAATGAGGCCGG - Intergenic
1060088146 9:120720047-120720069 AAAAGTAGAAATAATGAGCCGGG - Intergenic
1060440890 9:123638310-123638332 AAGATGAAAAAGAAAAAGGCAGG + Intronic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1061076171 9:128342893-128342915 AAGAGTGAGAAGCAGGAGGCTGG - Intronic
1061358358 9:130123496-130123518 AAGAAAAAAAAGAAATAGGCCGG - Intronic
1061389545 9:130309881-130309903 AAGAGGAAGAAGCATCAGGCCGG - Intronic
1061456620 9:130702887-130702909 GAGATTAAAAGGAATGGGGCAGG - Intronic
1061514384 9:131080270-131080292 AAAAAAAAAAGGAATGAGGCTGG - Intronic
1061788125 9:133043064-133043086 AAGAGTATAAAGATTGAGAAGGG + Intronic
1061793877 9:133072248-133072270 AAAAAAAAAAAGTATGAGGCCGG + Intronic
1062188965 9:135237209-135237231 CACATTAAGAAGAATGAGGCCGG + Intergenic
1062367981 9:136220959-136220981 AACAGTGAGAAAAATGAGGCTGG - Intronic
1203693930 Un_GL000214v1:76895-76917 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203705613 Un_KI270742v1:40536-40558 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203558382 Un_KI270744v1:25275-25297 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203633724 Un_KI270750v1:92933-92955 AGGAGCAGAAAGAATGAGGGGGG - Intergenic
1203642343 Un_KI270751v1:27168-27190 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203655678 Un_KI270752v1:21941-21963 AAAAAAAAAAAAAATGAGGCTGG - Intergenic
1185528279 X:796540-796562 AAGATTAAAAAAAATTAGCCAGG - Intergenic
1185597831 X:1318754-1318776 AAAAGTACAAAAAATGAGCCTGG + Intergenic
1185730202 X:2455449-2455471 AAAAGTAAAAACAAGTAGGCCGG + Intronic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1185835916 X:3345997-3346019 AAGAGTAGGAGGAAAGAGGCGGG + Intronic
1186074892 X:5867372-5867394 AAGAGTAGAATGAAAGAGGGAGG - Intronic
1186411787 X:9350424-9350446 AAGAGTAAAAAGCAAAAGCCAGG - Intergenic
1186687742 X:11943234-11943256 AAGAGTAAAAAGAAAAAGGCAGG - Intergenic
1187138645 X:16572057-16572079 AAAAGTAAAAAGAAACAGGTGGG - Intergenic
1187442722 X:19334611-19334633 AAGAGTACAAAAAATTAGCCAGG - Intergenic
1187444359 X:19347548-19347570 TAGAGTTGAAACAATGAGGCAGG - Intronic
1187867740 X:23739507-23739529 AAGATCAAAAAGAACCAGGCTGG + Intronic
1187924775 X:24239679-24239701 AAAAATAAAAAAAATGAGCCTGG - Intergenic
1188598817 X:31935272-31935294 AAGATTAAAAAGACTCAGGTAGG - Intronic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188671994 X:32891873-32891895 AAGAGAAAAAATGATTAGGCTGG - Intronic
1188711580 X:33406830-33406852 AAAAAAAAAAAGAATGAGTCAGG + Intergenic
1188821776 X:34784869-34784891 AAGAGAAAAAGGCAAGAGGCAGG - Intergenic
1188920218 X:35965781-35965803 AAGAGGGAAAAGAATGAGTTTGG - Intronic
1189352105 X:40283413-40283435 AAGAGAGAAAAGTATGTGGCGGG - Intergenic
1189696068 X:43664163-43664185 AAGAGTCAAAACATTCAGGCTGG + Intronic
1189761919 X:44330506-44330528 AACAGTAAAAAAAACAAGGCTGG + Intronic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190094775 X:47470115-47470137 AAGAGAAACATGACTGAGGCCGG + Intronic
1190328512 X:49221402-49221424 AAAAATAAAAACAGTGAGGCTGG - Intronic
1190662648 X:52669052-52669074 AAGAGAAAAAAAAAAAAGGCCGG - Intronic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192197341 X:69037240-69037262 AAGAGAAAAAAGAAAGAGAGAGG - Intergenic
1192379528 X:70601523-70601545 AAAAAAAAAAAGAATGATGCTGG - Intronic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1194162969 X:90478290-90478312 GAGAGTAAAAATAATGCAGCAGG + Intergenic
1194477041 X:94370810-94370832 AAGAATAAAAACAATGAAGCAGG + Intergenic
1195042167 X:101024525-101024547 AAAAATAAAAAAAATTAGGCCGG + Intronic
1195493604 X:105503457-105503479 AAGAGAAAAAAGAAGGAAGCTGG + Intronic
1195584793 X:106552604-106552626 AATAGTAAAAAAAAAAAGGCCGG + Intergenic
1195595094 X:106679857-106679879 AAAAGTAAAATGTTTGAGGCTGG + Intergenic
1195697964 X:107680650-107680672 GAGAGTAAAAAGGATGAGTAAGG - Intergenic
1195976080 X:110528545-110528567 CTGAGTAAAAAGAATAAAGCTGG + Intergenic
1196089095 X:111719825-111719847 ACCAGTAAAATGAATGAGGCAGG + Intronic
1196640825 X:118058295-118058317 AAGAGAAATAAAAATGAGGGGGG - Intronic
1196789215 X:119449115-119449137 TGTAGTATAAAGAATGAGGCCGG + Intronic
1196834439 X:119801606-119801628 AAGAGAAAGAAAAATGAGCCGGG - Intergenic
1197152797 X:123238364-123238386 AACAGGAAAAAGAATGAGATGGG + Intronic
1197753660 X:129981261-129981283 GAGAGTAAAAGGACTGTGGCGGG - Intronic
1198064916 X:133086613-133086635 AAAAGTAATAATAATAAGGCCGG + Intronic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199144092 X:144345774-144345796 ATAATTAAAAAGAATGAAGCAGG - Intergenic
1200065545 X:153502684-153502706 AAGGCTCAAAAGAATGAGGGAGG + Intronic
1200840000 Y:7772084-7772106 GGGAGTAATGAGAATGAGGCAGG - Intergenic
1200919898 Y:8603926-8603948 AGGAGTAAAAAGGATAATGCTGG + Intergenic
1200977229 Y:9226239-9226261 AAAAAAAAAAAGAATGAGCCAGG - Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201374859 Y:13308320-13308342 AATAGAATAAACAATGAGGCCGG + Intronic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic
1202389076 Y:24351491-24351513 AAAAGAAAAAAGAATTAGCCAGG - Intergenic
1202481711 Y:25318633-25318655 AAAAGAAAAAAGAATTAGCCAGG + Intergenic