ID: 1017202477

View in Genome Browser
Species Human (GRCh38)
Location 6:151770823-151770845
Sequence CTAATCTATCACATTAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017202477 Original CRISPR CTAATCTATCACATTAGACC TGG Intronic
902669078 1:17959947-17959969 TTAATCTATCACATGAGAGAGGG - Intergenic
907063682 1:51457687-51457709 GTAACTTATCACATGAGACCAGG + Intronic
909626167 1:77718349-77718371 CTAATTTTACACTTTAGACCTGG + Intronic
911128091 1:94360263-94360285 CTACTCTATCACTTTGCACCTGG - Intergenic
916179577 1:162071667-162071689 CTCATCTCTCAGAATAGACCTGG + Intronic
917697759 1:177544995-177545017 CTAATCTTTCACTTTAGGACAGG + Intergenic
1063361434 10:5462746-5462768 CAGATCTATCAAGTTAGACCTGG + Intergenic
1063653072 10:7959765-7959787 CAATTCTATCAGATTAGAACTGG - Intronic
1071387651 10:85138606-85138628 CTAGGCCATCACAGTAGACCAGG + Intergenic
1087305126 11:96480304-96480326 ATAATCTATACCCTTAGACCAGG - Intronic
1089183929 11:116602172-116602194 CTAATCCATCACTGTAGAGCAGG - Intergenic
1091746053 12:2993771-2993793 CTAAGCAGTCACATTAGGCCAGG - Intronic
1093278647 12:17161772-17161794 CTTATCTATAAAATTAGACAAGG + Intergenic
1095351329 12:41217075-41217097 CTAACCTATCAGTTTTGACCAGG - Intronic
1100488883 12:95058921-95058943 ATAATATATTACATTAGGCCAGG - Intronic
1105722447 13:23130346-23130368 ATAATCTATAAAATTAGTCCAGG - Intergenic
1109788424 13:67213677-67213699 TTAATCTAACACATAAAACCTGG - Intronic
1110363870 13:74659608-74659630 CTCATATATCACTTTAGAGCAGG - Intergenic
1124181177 15:27476109-27476131 ATAATCTATAAAATTAGTCCAGG + Intronic
1131396330 15:92089443-92089465 CAAATCTATCACATGATATCAGG - Intronic
1140067604 16:71625057-71625079 TTCATCTATCACAATAGTCCTGG - Intergenic
1146200781 17:30856385-30856407 CTAAACTTTCAAGTTAGACCTGG - Intronic
1159286919 18:66365755-66365777 CTGATCTCTCACATTACACGTGG + Intergenic
1159764991 18:72478742-72478764 CTAATCTAGCACACTAGGGCTGG + Intergenic
1164286154 19:23819542-23819564 CCAATTTATCCCTTTAGACCCGG - Intronic
928682732 2:33718907-33718929 CAAATCTATCTCATTATATCTGG - Intergenic
929522495 2:42666594-42666616 CTAATCCATCACTTTAGGGCAGG + Intronic
931018276 2:58011511-58011533 CTAATGAATCACATTAAATCAGG + Intronic
943812527 2:192206805-192206827 CTTATCTATCACATGACACTAGG - Intergenic
943986115 2:194621258-194621280 ATAAGCTATCACTATAGACCTGG - Intergenic
947091384 2:226515569-226515591 TTAACCTATGAAATTAGACCAGG + Intergenic
960209450 3:114942565-114942587 CTACTCTATCACAGTAGAACTGG - Intronic
964142224 3:153417037-153417059 CTAATCTATCACAATCAAGCAGG - Intergenic
964288311 3:155145956-155145978 CAAATCTGTCACATGAGCCCAGG - Intronic
964966594 3:162501806-162501828 CTAATCTATCTCATTGGTTCTGG - Intergenic
970674810 4:18436976-18436998 CTAATATCTCACATGAGAACAGG - Intergenic
976015339 4:80545894-80545916 CTAATCTACCACAATCGAGCAGG + Intronic
983609731 4:169629664-169629686 AAAATATGTCACATTAGACCAGG - Intronic
996522003 5:124437641-124437663 CCAATTCAACACATTAGACCTGG + Intergenic
999648542 5:153743148-153743170 CTAATCTATCATTTTAGCCTCGG - Intronic
1004111795 6:12725665-12725687 CTAATCAATAACAATAGACAAGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004740230 6:18453012-18453034 CTGGCCTATCACATTAGCCCAGG - Intronic
1004753777 6:18589548-18589570 CTAATCAATTACATTTGATCGGG + Intergenic
1005848109 6:29798369-29798391 AGAGTCTATCACATTAGGCCTGG + Intergenic
1009803005 6:68566336-68566358 GCAATCTATCACATGAGATCAGG - Intergenic
1015680974 6:135808063-135808085 CTAATCAAGCTCATGAGACCTGG - Intergenic
1015958360 6:138621713-138621735 CTAATCAATCACATTTGAGGCGG - Intronic
1017202477 6:151770823-151770845 CTAATCTATCACATTAGACCTGG + Intronic
1021278291 7:18683959-18683981 CAAAACTATCATGTTAGACCAGG + Intronic
1024434066 7:49328282-49328304 ATAAGCTATCACTATAGACCTGG + Intergenic
1026458206 7:70591187-70591209 CTAATCTTTCACATTTGCCTTGG - Intronic
1036501110 8:9314642-9314664 CTGATCTGTGACATTAAACCAGG - Intergenic
1038533271 8:28335952-28335974 CTCATCTGTCCCATTAGTCCAGG - Intronic
1043625517 8:82253145-82253167 TTAATCCATCAGATTTGACCTGG + Intergenic
1044593581 8:93937524-93937546 ATAATCAATCACATTCCACCTGG - Intergenic
1046841591 8:118864424-118864446 CTAATCATTCACATTTGACACGG + Intergenic
1048242733 8:132759957-132759979 CTAATATATTACATTACACTGGG - Intronic
1048916538 8:139189511-139189533 ATAATATATCTCATTAGATCAGG - Intergenic
1050009403 9:1170831-1170853 CTGATTTATCATATTAGACTGGG - Intergenic
1052139917 9:24968080-24968102 CTAGACTCTCACATTAGACTAGG - Intergenic
1059096991 9:111427737-111427759 GCAATCCATCACATGAGACCAGG + Intronic
1059505847 9:114799291-114799313 CTGAGCCATCACAATAGACCTGG - Intronic
1060867676 9:127012924-127012946 CTTACCTTTCCCATTAGACCAGG - Intronic
1186959835 X:14723799-14723821 CTTATCTGTCAGATTAGACCAGG + Intronic
1188102664 X:26109156-26109178 CTAATGTATGACATTGGACAAGG + Intergenic
1189180265 X:38997312-38997334 CTAATCCATCACATTGGTCATGG - Intergenic
1194251780 X:91584922-91584944 GGAATTTATTACATTAGACCAGG - Intergenic
1198331713 X:135628594-135628616 CTATTCTATCTAAATAGACCTGG + Intergenic
1200570715 Y:4826153-4826175 GGAATTTATTACATTAGACCAGG - Intergenic