ID: 1017204534

View in Genome Browser
Species Human (GRCh38)
Location 6:151790460-151790482
Sequence TGAACCCCTTCCACAACAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017204534 Original CRISPR TGAACCCCTTCCACAACAGG TGG (reversed) Intronic
900762916 1:4484962-4484984 TGAGCCACTTCCACATCAGCAGG - Intergenic
900825467 1:4923057-4923079 TGAGTCCCTCCCACAACAAGTGG + Intergenic
901133369 1:6976818-6976840 TGAGTCCCTCCCACAACAAGTGG - Intronic
905959040 1:42027901-42027923 TGGGCCCCTCCCACAACATGTGG + Intronic
906808087 1:48799250-48799272 TCAACCCCTTTTACAACAGCTGG - Intronic
907064783 1:51470195-51470217 TAAAACCCTTCCATAATAGGGGG + Intronic
908373398 1:63506497-63506519 TGGGTCCCTCCCACAACAGGTGG + Intronic
909066181 1:70938798-70938820 TAGGCTCCTTCCACAACAGGTGG + Intronic
909066468 1:70940726-70940748 TGGGCCCCTCCCACAACACGTGG + Intronic
909681114 1:78293430-78293452 TGGGTCCCTCCCACAACAGGTGG - Intergenic
910167077 1:84338839-84338861 TGGGCCCCTCCCACAACATGTGG + Intronic
910817717 1:91310609-91310631 TCAGTCCCTTCCACAACACGTGG - Intronic
911275116 1:95850663-95850685 TGGGTCCCTTTCACAACAGGAGG - Intergenic
911407038 1:97454012-97454034 TTAACCCATTCTACAACAGTAGG - Intronic
911686407 1:100781868-100781890 TGAGTCCCTCCCACAACATGTGG + Intergenic
913081723 1:115394709-115394731 TGGGTCCCTTCCACAACATGTGG + Intergenic
913101579 1:115572599-115572621 TGAGTCCCTCCCACAACAGGTGG - Intergenic
913110247 1:115651042-115651064 TGAACCCCTACCACAGCAGCAGG - Intronic
913316473 1:117558161-117558183 TGGATCCCTCCCACAACATGTGG + Intergenic
914078806 1:144385299-144385321 TGGGCCCCTCCCACAACATGTGG + Intergenic
914100373 1:144581203-144581225 TGGGCCCCTCCCACAACATGTGG - Intergenic
914173712 1:145253844-145253866 TGGGCCCCTCCCACAACATGTGG + Intergenic
914298618 1:146356479-146356501 TGGGCCCCTCCCACAACATGTGG + Intergenic
914528371 1:148495030-148495052 TGGGCCCCTCCCACAACATGTGG + Intergenic
914638020 1:149572075-149572097 TGGGCCCCTCCCACAACATGTGG - Intergenic
916449183 1:164903474-164903496 TGAGTCCCTCCCACAACATGTGG - Intergenic
916814294 1:168336973-168336995 TGGATCCCTCCCACAACATGTGG + Intergenic
916814587 1:168338912-168338934 TGGGTCCCTCCCACAACAGGTGG + Intergenic
917082332 1:171268861-171268883 TGAGTCCCTCCCACAACATGTGG - Intronic
917801869 1:178579140-178579162 TGAGCCCTTTCCAAAGCAGGCGG + Intergenic
919307866 1:195867035-195867057 TGGGCCCCTCCCACAACATGTGG + Intergenic
919514146 1:198500826-198500848 TGGATCCCTCCCACAACATGTGG - Intergenic
919756047 1:201066778-201066800 TGGGCCCCTGCCACAAGAGGAGG - Intronic
920695727 1:208180115-208180137 TGTTCCTCCTCCACAACAGGCGG + Intronic
920806002 1:209233771-209233793 TGCTCACCATCCACAACAGGAGG - Intergenic
920949334 1:210557762-210557784 TGGATCCCTCCCACAACACGTGG + Intronic
923805745 1:237256069-237256091 TGAGTCCCTCCCACAACATGTGG - Intronic
923920483 1:238558865-238558887 TGCACCCCTACCACACCATGAGG - Intergenic
924159813 1:241219189-241219211 TGAGTCCCTCCCACAACATGTGG - Intronic
1064909216 10:20382314-20382336 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1065770239 10:29071360-29071382 TGAGTCCCTCCCACAACATGAGG + Intergenic
1065950382 10:30646076-30646098 TGCACCCCAGCAACAACAGGAGG + Intergenic
1068473524 10:57495670-57495692 CGAGCCCCTTCCACCACATGTGG + Intergenic
1070989738 10:80721173-80721195 TGGGTCCCTTCCACAACACGTGG + Intergenic
1072640739 10:97209368-97209390 TGGACCCCTTCCACCATAGAGGG - Intronic
1073654859 10:105402803-105402825 TGGATCCCTTCCACAACACATGG - Intergenic
1073765243 10:106675082-106675104 AGAACCCCATCCACAAAAAGTGG + Exonic
1073787533 10:106906639-106906661 TGGGTCCCTTCCACAACACGTGG + Intronic
1073887478 10:108056712-108056734 TGGATCCCTCCCACAACATGTGG + Intergenic
1074178150 10:111032101-111032123 TGGGCCCCTCCCACAACATGGGG + Intergenic
1074262862 10:111871203-111871225 TGGGTCCCTTCCACAACAGTGGG - Intergenic
1074689550 10:115991967-115991989 TGGGCCCCTCCCACAACACGTGG - Intergenic
1075126748 10:119706560-119706582 TGGGCCCCTCCCACAACATGTGG - Intergenic
1075550476 10:123389066-123389088 CGAGTCCCTTCCACAACATGTGG - Intergenic
1075844523 10:125534729-125534751 TGGATCCCTCCCACAACATGTGG + Intergenic
1076464979 10:130673031-130673053 TGGATCCCTCCCACAACATGGGG + Intergenic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078365163 11:10700339-10700361 TGGGCCCCTCCCACAACATGTGG - Intergenic
1080841448 11:35987124-35987146 TGACCCACCTCCACCACAGGAGG - Intronic
1080927047 11:36768456-36768478 TGAGTCCCTTCCACAACACATGG + Intergenic
1080991716 11:37545191-37545213 TGAGTCCCTTCCACAACAAGTGG + Intergenic
1081002911 11:37696428-37696450 TGGGCCCCTCCCACAACATGTGG - Intergenic
1081157905 11:39716991-39717013 TGAGTCCCTCCCACAACACGTGG - Intergenic
1081400502 11:42636817-42636839 TGAGTCCCTCCCACAACATGTGG - Intergenic
1081440473 11:43075636-43075658 TGGCTCCCTCCCACAACAGGTGG + Intergenic
1082652212 11:55807403-55807425 TGGGTCCCTTCCACAACACGTGG + Intergenic
1082766053 11:57168928-57168950 TGGGTCCCTTCCACAACACGTGG + Intergenic
1082782195 11:57296294-57296316 TGAGTCCCTTTCACAACATGTGG - Intergenic
1083000032 11:59283053-59283075 TGGAGCCCTTCCAGATCAGGGGG - Intergenic
1083777370 11:64900777-64900799 TGAGCCCCATCCACCCCAGGTGG - Intronic
1083863951 11:65443539-65443561 AGGACCCCAACCACAACAGGTGG - Intergenic
1084390853 11:68875776-68875798 TGGGTCCCTTCCACAACACGTGG - Intergenic
1085651377 11:78271850-78271872 TGGATCCCTCCCACAACACGTGG - Intronic
1085754883 11:79193996-79194018 TGAGTCCCTCCCACAACAGGTGG - Intronic
1085995566 11:81908701-81908723 TGAGTCCCTTCCACAACACGTGG - Intergenic
1086323130 11:85671293-85671315 TGGGTCCCTTCCACAACATGTGG + Intronic
1086580236 11:88391068-88391090 TGTATCCCTTCCACTACATGTGG + Intergenic
1086721557 11:90127809-90127831 TGGGTCCCTTCCACAACAGCAGG + Intergenic
1087550089 11:99638296-99638318 TGGGTCCCTTCCACAACATGTGG + Intronic
1087966739 11:104424032-104424054 TTCACCCCTTCCACCACTGGAGG + Intergenic
1088111369 11:106266040-106266062 TGGGTCCCTCCCACAACAGGTGG - Intergenic
1089050965 11:115545639-115545661 AAAACCCCTTCTACAACAGCTGG - Intergenic
1089296078 11:117469141-117469163 TTATCCCCTTCCACCAGAGGAGG - Intronic
1090179493 11:124684008-124684030 TGCATCCCTCCCACAACATGTGG - Intronic
1090321439 11:125847107-125847129 TGGATCCCTCCCACAACAGATGG + Intergenic
1090727249 11:129539227-129539249 TGGATCCCTCCCACAACATGTGG + Intergenic
1092184231 12:6466889-6466911 TGAGTCCCTCCCACAACATGTGG - Intronic
1093142005 12:15519299-15519321 TGGGCCCCTCCCACAACACGTGG + Intronic
1093991834 12:25597923-25597945 TGAGCTCCTCCCACAACAAGTGG - Intronic
1095544022 12:43344255-43344277 TGGATCCCTCCCACAACATGTGG + Intergenic
1095847327 12:46759754-46759776 TGGGTCCCTTCCACAACATGAGG - Intergenic
1097360363 12:58653304-58653326 TGGACCCCTCCCACAACATGTGG + Intronic
1098026879 12:66213285-66213307 TGGGCCCCTCCCACAACACGTGG + Intronic
1098778403 12:74653240-74653262 TGAGTCCCTCCCACAACACGTGG + Intergenic
1099507613 12:83499136-83499158 TGGGTCCCTGCCACAACAGGTGG - Intergenic
1099812684 12:87604987-87605009 TGAGTCCCTTCTACAACACGTGG + Intergenic
1099846039 12:88030373-88030395 TGAATCCCTCCCACAACATGTGG + Intronic
1100294045 12:93244260-93244282 TCAACCCCTCCCACTTCAGGAGG + Intergenic
1100339465 12:93664511-93664533 TGCATCCCTCCCACAACAGATGG + Intergenic
1100947972 12:99808721-99808743 TGAATCCCTTTCAGACCAGGGGG - Intronic
1102523022 12:113491030-113491052 TAGACCCCTCCCACAACATGTGG - Intergenic
1104275382 12:127322379-127322401 TGGATCCCTCCCACAACACGTGG + Intergenic
1106382520 13:29253955-29253977 TGAGTCCCTCCCACAACACGTGG + Intronic
1108050118 13:46426743-46426765 TGGGTCCCTTCCACAACACGTGG - Intronic
1108059984 13:46523164-46523186 TGAACCCTTTCAATGACAGGAGG + Intergenic
1108184197 13:47872561-47872583 TGGATCCCTCCCACAACATGTGG + Intergenic
1108603540 13:52015533-52015555 TGGATCCCTCCCACAACATGTGG - Intronic
1108724199 13:53162961-53162983 TGGGCCCCTCCCACAACACGTGG + Intergenic
1108944265 13:56002189-56002211 TGAGTCCCTCCCACAACACGTGG + Intergenic
1109482591 13:62974993-62975015 TGCATCCCTCCCACAACACGTGG + Intergenic
1109526445 13:63581589-63581611 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1109542638 13:63800052-63800074 TGGGTCCCTTCCACAACACGTGG - Intergenic
1109810563 13:67508324-67508346 TGGGCCCCTCCCACAACATGTGG - Intergenic
1110083531 13:71346936-71346958 TGAATCCCTCCCACAACACGTGG + Intergenic
1110591778 13:77271530-77271552 TGGGTCCCTTCCACAACACGTGG - Intronic
1110902916 13:80846149-80846171 TGGGCCCCTCCCACAACATGTGG - Intergenic
1111155055 13:84310574-84310596 TGGATCCCTCCCACAACATGTGG - Intergenic
1111924984 13:94453632-94453654 TACATCCCTTCCACAACATGTGG - Intronic
1112008384 13:95273696-95273718 TGGATCCCTCCCACAACATGTGG - Intronic
1112253216 13:97802978-97803000 TGGGTCCCTTCCACAACATGAGG - Intergenic
1112281739 13:98068864-98068886 TGATTCCCTTCCACAACACCTGG - Intergenic
1112856902 13:103783514-103783536 TGGGTCCCTTCCACAACATGTGG + Intergenic
1113525821 13:110975066-110975088 TGAGTCCCTCCCACAACACGTGG - Intergenic
1113800196 13:113082524-113082546 TCTATCACTTCCACAACAGGTGG + Exonic
1115143625 14:30201655-30201677 TGGGTCCCTCCCACAACAGGTGG - Intergenic
1116048061 14:39768442-39768464 TGAAACCCTTCCAAAAAGGGAGG - Intergenic
1116100331 14:40425572-40425594 TGGGTCCCTTCCACAACACGTGG + Intergenic
1116400467 14:44500273-44500295 TGCATCCCTCCCACAACACGTGG + Intergenic
1119383888 14:74245435-74245457 TGAACACCTGCCACATGAGGTGG + Intronic
1120056132 14:79926312-79926334 CGCATCCCTCCCACAACAGGTGG - Intergenic
1120062164 14:79996940-79996962 TGAATCCCTTCCACATTAGAGGG - Intergenic
1120152821 14:81056017-81056039 TGAGTCCCTCCCACAACATGTGG - Intronic
1120476709 14:84997973-84997995 TGAGTCCCTCCCACAACACGTGG - Intergenic
1120910893 14:89665728-89665750 TGGGCCCCTCCCACAACACGTGG - Intergenic
1121147139 14:91593864-91593886 TGGGTCCCTTCCACAACATGCGG - Intronic
1121825515 14:97007109-97007131 TGGATCCCTCCCACAACATGTGG - Intergenic
1121882009 14:97508985-97509007 TGGATCCCTCCCACAACACGTGG - Intergenic
1122158090 14:99762987-99763009 TGAGTCCCTCCCACAACACGTGG - Intronic
1122360140 14:101154326-101154348 TGCACCCCTCCCACGACAGGTGG - Intergenic
1122854567 14:104554029-104554051 TGAGCTCCTTCCTCAAAAGGTGG - Intronic
1123045958 14:105514905-105514927 TGGGTCCCTCCCACAACAGGTGG - Intergenic
1123716549 15:23037434-23037456 TGAACACATTCTACATCAGGTGG + Intronic
1125162594 15:36663440-36663462 TGGGTCCCTTCCACAACACGTGG - Intronic
1125370196 15:38967267-38967289 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1125529990 15:40406793-40406815 TGAACCCTTTCCACTTGAGGTGG - Intronic
1126574415 15:50183073-50183095 TTATCAGCTTCCACAACAGGTGG - Intronic
1127043495 15:55002318-55002340 TGAGTCCCTCCCACAACATGTGG + Intergenic
1128177249 15:65566606-65566628 TGGGTCCCTTCCACAACATGTGG + Intronic
1129947996 15:79558879-79558901 TGCTCACCATCCACAACAGGAGG + Intergenic
1130141255 15:81228182-81228204 TGTACCTATTCCACAGCAGGAGG + Intronic
1131603971 15:93881035-93881057 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1131619730 15:94054891-94054913 TGAGTCCCTTCTACAACATGTGG - Intergenic
1132388026 15:101415685-101415707 TGAGTCCCTCCCACAACATGTGG - Intronic
1133883702 16:9806891-9806913 TGGGTCCCTCCCACAACAGGTGG - Intronic
1134399120 16:13892610-13892632 TGGACCCCTTCCATCACAGCAGG + Intergenic
1134651943 16:15916448-15916470 TGGGTCCCTTCCACAACACGTGG + Intergenic
1134869427 16:17638422-17638444 TGGGTCCCTTCCACAACACGTGG + Intergenic
1135064570 16:19298704-19298726 TGAACTCCATCCAGAACAGGGGG - Exonic
1135150149 16:19998484-19998506 CGAGCCCCTCCCACAACATGTGG + Intergenic
1135495366 16:22947005-22947027 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1135731384 16:24897855-24897877 TGACTCCCTCCCACAACATGTGG + Intronic
1135845324 16:25913372-25913394 TGCACCCCTTCCACCACCTGAGG + Intronic
1137691655 16:50432196-50432218 TGCATCCCTCCCACAACATGTGG - Intergenic
1137760627 16:50937312-50937334 TGGGGCCCTTCCACAACAGGTGG - Intergenic
1138603507 16:58072187-58072209 TGGATCCTTCCCACAACAGGTGG - Intergenic
1138695212 16:58806735-58806757 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1139011016 16:62634191-62634213 TGTGTCCCTTCCACAACATGTGG + Intergenic
1139061028 16:63251663-63251685 TGAACACATTCCACAAATGGTGG - Intergenic
1140042982 16:71421752-71421774 TGGACCCATTCCACACCAGGTGG + Intergenic
1140824897 16:78696675-78696697 TGTACCCCCCCCAAAACAGGTGG - Intronic
1143991493 17:10967194-10967216 TTAGCCCCTTCCACCACATGCGG + Intergenic
1147650042 17:42056652-42056674 TGGATCCCTCCCACAACATGAGG - Intronic
1148816263 17:50330127-50330149 TCAGACCCTTCCACAATAGGAGG + Intergenic
1149448351 17:56731189-56731211 TGAGTCCCTCCCACAACATGTGG - Intergenic
1149959315 17:61090162-61090184 CACACCCCTTCCACAAAAGGTGG - Intronic
1150283288 17:63941635-63941657 TCAACCCCATCCTCAACAGCGGG - Exonic
1150545093 17:66148284-66148306 TGAGGCCCTCCCACAACATGTGG + Intronic
1150582197 17:66484217-66484239 TGGGCCCCTCCCACAACACGTGG + Intronic
1153199170 18:2632080-2632102 TGGGTCCCTTCCACAACACGTGG - Intergenic
1155356377 18:24957775-24957797 TGGATCCCTCCCACAACATGTGG + Intergenic
1155880396 18:31140870-31140892 TGGGTCCCTCCCACAACAGGTGG - Intronic
1156081257 18:33339624-33339646 TGGGTCCCTTCCACAACATGTGG - Intronic
1156909024 18:42388803-42388825 TGAGTCCCTCCTACAACAGGTGG + Intergenic
1157609930 18:48949935-48949957 TGAACACTTTGCACAGCAGGAGG + Exonic
1160003421 18:75049330-75049352 TGAAACCCTGCCAGAGCAGGAGG - Intronic
1160266052 18:77341430-77341452 AGGCCCCCTTCCTCAACAGGAGG - Intergenic
1163815550 19:19462624-19462646 TGACCTGCTACCACAACAGGGGG + Intronic
1165083222 19:33323370-33323392 TGAGTCCCTCCCACAACACGTGG + Intergenic
1167845908 19:52163999-52164021 TGAAACCCTGCCACAAAAGAAGG + Intronic
1168702564 19:58450017-58450039 GGGGCCCCTTCCACAACATGTGG - Intergenic
925775367 2:7330099-7330121 TGGGTCCCTCCCACAACAGGTGG - Intergenic
925781840 2:7388685-7388707 TGAGTCCCTTCCACAACATGTGG + Intergenic
925834602 2:7931865-7931887 TGAGTCCCTCCCACAACATGTGG - Intergenic
926330664 2:11822660-11822682 TGAGTCCCTCCCACAACACGTGG + Intronic
926970853 2:18465959-18465981 TGGGTCCCTCCCACAACAGGTGG + Intergenic
927228396 2:20794280-20794302 TGAGCCCCTCCCACAACACGTGG + Intronic
927341122 2:21983866-21983888 TGGGTCCCTCCCACAACAGGTGG + Intergenic
928927526 2:36594609-36594631 TGGATCCCTCCCACAACACGTGG + Intronic
929687635 2:44048160-44048182 TGAGTCCCTCCCACAACACGTGG + Intergenic
930448431 2:51503766-51503788 TGGTTCCCTTCCACAACATGTGG + Intergenic
930921883 2:56765879-56765901 TGAGTCCCTCCCACCACAGGTGG - Intergenic
930997220 2:57734773-57734795 TGGTCCCCTCCCACAACACGTGG + Intergenic
931929581 2:67115340-67115362 TGGATCCCTCCCACAACATGTGG - Intergenic
932629725 2:73329428-73329450 TGAGCCCCTTCCATAAAACGTGG - Intergenic
935625794 2:105171456-105171478 TGGATCCCTCCCACAACATGTGG + Intergenic
935694884 2:105762388-105762410 TGAACCCCTTTCAAAGCAGAGGG - Intronic
936543779 2:113373174-113373196 TGGGTCCCTTCCACAACACGCGG + Intergenic
939037564 2:137150376-137150398 TGAGCCCCTCCCACAACATGTGG - Intronic
939079311 2:137640131-137640153 TGGGTCCCTCCCACAACAGGTGG - Intronic
940082787 2:149823519-149823541 TGAGTCCCTCCCACAACACGTGG + Intergenic
942388059 2:175462560-175462582 TGACCCCCTTCCCCAACATTTGG - Intergenic
943003543 2:182360731-182360753 TGGGCCCCTTCCACCATAGGGGG - Intronic
943220237 2:185094593-185094615 TGGGCCCCTCCCACAACATGTGG - Intergenic
943372037 2:187027959-187027981 TGAATCCCTCCCACAACACATGG + Intergenic
944384463 2:199149249-199149271 TGAGTCCCTTCCACAACACATGG - Intergenic
944800029 2:203230087-203230109 TGGATCCCTCCCACAACATGTGG - Intergenic
945065064 2:205941308-205941330 TGGGTCCCTTCCACAACATGTGG - Intergenic
945754901 2:213833968-213833990 TGGGCCCCTTCCACAACACGTGG - Intronic
946062513 2:216956307-216956329 TGGATCCCTTCCACAAAATGTGG + Intergenic
946166862 2:217869756-217869778 TGAACCCCTTCAATAGCAGACGG + Intronic
946574406 2:221058335-221058357 TGAGTCCCTCCCACAACACGTGG + Intergenic
947149512 2:227100739-227100761 TGGGTTCCTTCCACAACAGGTGG - Intronic
948043151 2:234920317-234920339 TGAGTCCCTCCCACAACATGTGG + Intergenic
1168806831 20:676524-676546 TGAACCCCAAACCCAACAGGGGG - Intergenic
1169249579 20:4050026-4050048 TGGGCCCCTCCCACAACATGGGG + Intergenic
1170475132 20:16706888-16706910 TGAGTCCCTTCCACAACACACGG - Intergenic
1171118583 20:22548725-22548747 CGAGTCCCTTCCACAACACGTGG + Intergenic
1173071012 20:39765114-39765136 TGGGTCCCTCCCACAACAGGTGG - Intergenic
1173917547 20:46719621-46719643 TGGGTCCCTTCCACAACATGAGG + Intronic
1174655552 20:52169430-52169452 TGAACACCTTCCAGCACAGGGGG - Intronic
1176657839 21:9603747-9603769 TGGATCCCTCCCACAACATGTGG + Intergenic
1177479499 21:21668809-21668831 TGAGTCCCTCCCACAACATGTGG + Intergenic
1178300765 21:31450880-31450902 TGGGTCCCTTCCACAACATGTGG + Intronic
1179235862 21:39545276-39545298 TGGGTCCCTCCCACAACAGGTGG - Intergenic
1179322144 21:40302244-40302266 TGGATCCCTCCCACAATAGGTGG - Intronic
1179367097 21:40768708-40768730 TGAAGCACTTCCACATCAGGAGG - Intronic
1179384611 21:40930296-40930318 TGGATCCCTTCCACAACACATGG + Intergenic
1179429703 21:41312084-41312106 TAGACCCCTCCCACAACATGTGG + Intronic
1179448778 21:41453284-41453306 TGAGTCCCTCCCACAACAGGTGG + Intronic
1179473038 21:41624657-41624679 TGAGTCCCTCCCACAACAAGTGG + Intergenic
1181678933 22:24477694-24477716 TAAACCCTTTCCACTACACGTGG - Intergenic
1184269682 22:43372174-43372196 TGGGCCCCTCCCACAACACGTGG + Intergenic
1184735711 22:46396688-46396710 TGAACCCCTGCGAGAACATGGGG - Exonic
1184887922 22:47357729-47357751 TGGATACCTTCAACAACAGGCGG + Intergenic
949745909 3:7291854-7291876 TGGGCCCCTCCCACAACATGTGG - Intronic
951483199 3:23183542-23183564 GGAACCCCTCCTAAAACAGGTGG - Intergenic
955435358 3:58894091-58894113 TGAGTCCCTCCCACAACACGTGG + Intronic
955970773 3:64436187-64436209 TGAGTCCCTTCCACAACACATGG - Intronic
956540209 3:70328182-70328204 TGTGTCCCTTCCACAACACGTGG + Intergenic
956712832 3:72053151-72053173 CGAGCCCCTCCCACAACACGTGG - Intergenic
956820107 3:72946596-72946618 CTCACCCCTTCCACCACAGGAGG - Intronic
958023366 3:88022524-88022546 TGAGTCCCTCCCACAACATGTGG + Intergenic
958563933 3:95782409-95782431 TGAGTCCCTCCCACAACACGTGG - Intergenic
958588287 3:96118891-96118913 TGGGTCCCTTCCACAACATGTGG - Intergenic
958600207 3:96287821-96287843 TGAGCCCCTCCCACAACACGTGG - Intergenic
958684591 3:97377169-97377191 TGAGTCCCTCCCACAACACGTGG - Intronic
959095278 3:101949028-101949050 TGGGTCCCTCCCACAACAGGTGG - Intergenic
959155228 3:102658807-102658829 TGGGTCCCTTCCACAACACGTGG - Intergenic
959235802 3:103719836-103719858 TGAGTCCCTCCCACAACACGTGG + Intergenic
959339391 3:105110011-105110033 TGGGCCCCTCCCACAACAAGTGG + Intergenic
959416980 3:106087375-106087397 TTACCCCCTTCCACAATGGGAGG - Intergenic
959492096 3:107002277-107002299 TGTGTCCCTCCCACAACAGGTGG + Intergenic
959818675 3:110705392-110705414 TGGATCCCTCCCACAACAAGTGG + Intergenic
960842783 3:121977521-121977543 TGGGTCCCTGCCACAACAGGTGG - Intergenic
961783936 3:129338066-129338088 TGAGTCCCTCCCACAACATGTGG - Intergenic
962348566 3:134640415-134640437 TGATAACCTTCCACAAAAGGTGG + Intronic
963010228 3:140761529-140761551 TGGGCCCCTCCCACAACACGTGG + Intergenic
963368572 3:144368762-144368784 TGGATCCCTCCCACAACATGTGG + Intergenic
963683756 3:148411968-148411990 TGAGTCCCTCCCACAACACGTGG + Intergenic
963952695 3:151220522-151220544 TGGCTCCCTTCCACAACATGTGG - Intronic
964459557 3:156908945-156908967 TGTGTCCCTTCCACAACATGTGG - Intronic
964789498 3:160439536-160439558 TGAGTCCCTCCCACAACATGTGG - Intronic
964893529 3:161565926-161565948 TGGATCCCTCCCACAACATGTGG - Intergenic
965087061 3:164112990-164113012 TGGGTCCCTTCCACAACATGTGG + Intergenic
965198963 3:165632112-165632134 TGGATCCCTCCCACAACATGTGG - Intergenic
965794294 3:172422915-172422937 TGAGTCCCTCCCACAACACGTGG - Intergenic
965888894 3:173485236-173485258 TGAGTCCCTCCCACAACATGTGG + Intronic
966075098 3:175925878-175925900 TGAGTCCCTCCCACAACATGTGG + Intergenic
967689669 3:192458866-192458888 TGGATCCCTCCCACAACACGTGG - Intronic
969831280 4:9799417-9799439 TTGACCCCTTCCACCACATGAGG - Intronic
970217919 4:13778938-13778960 TGGGCCCCTCCCACAACATGTGG + Intergenic
970361093 4:15309582-15309604 TGGGCCCCTCCCACAACATGTGG + Intergenic
970420776 4:15904038-15904060 TGAGTCCCTCCCACAACACGTGG - Intergenic
970457654 4:16240873-16240895 TGGGTCCCTTCCACAACATGTGG - Intergenic
970976378 4:22047481-22047503 TTAGTCCCTTCCACAACACGTGG + Intergenic
971705644 4:30039018-30039040 TGAGTCCCTCCCACAACATGTGG + Intergenic
971876403 4:32314473-32314495 TGAGTCCCTTCCACAACACATGG - Intergenic
972113391 4:35594916-35594938 TGAGTCCCTCCCACAACACGTGG + Intergenic
972363226 4:38348216-38348238 TGGGTCCCTCCCACAACAGGTGG + Intergenic
972712283 4:41609428-41609450 TGAACAGCTTCCACAACCAGAGG + Intronic
972732770 4:41811550-41811572 TGGATCCCTGCCACAATAGGTGG + Intergenic
972958151 4:44417797-44417819 GGAAGTCCTTCCACAACAGAAGG + Intronic
973061665 4:45733941-45733963 TGGGTCCCTTCCACAACACGTGG + Intergenic
973128132 4:46614457-46614479 TGAGTCCCTCCCACAACATGTGG + Intergenic
973319021 4:48791090-48791112 TGGGCCCCTCCCACAACATGTGG - Intergenic
973552487 4:52049550-52049572 TGGACCCCTCCCACAACACGTGG + Intergenic
974466980 4:62270508-62270530 TGAGTCCCTCCCACAACACGTGG - Intergenic
974480741 4:62439327-62439349 TGATTCCCTCCCACAACATGTGG + Intergenic
974853657 4:67433634-67433656 TGGGCCCCTCCCACAACACGTGG - Intergenic
974925319 4:68291572-68291594 TGAGTCCCTTCCACAACACATGG + Intergenic
977384653 4:96324015-96324037 TGAGTCCCTCCCACAACACGTGG + Intergenic
977704219 4:100053208-100053230 TGGATCCCTCCCACAACATGTGG + Intergenic
977757741 4:100693584-100693606 TGGGTCCCTTCCACAACATGTGG - Intronic
978368969 4:108011460-108011482 TGGGCCCCTCCCACAACACGTGG + Intronic
979093566 4:116517600-116517622 TGGACCCATCCCACAACATGTGG + Intergenic
979734538 4:124066178-124066200 TGAGTCCCTCCCACAACACGTGG + Intergenic
979806461 4:124978626-124978648 TGAGTCCCTCCCACAACACGTGG - Intergenic
979845390 4:125503168-125503190 TGGGTCCCTTCCACAACACGTGG + Intergenic
980335680 4:131469771-131469793 TGAGTCCCTTCCACAACACATGG - Intergenic
980755196 4:137149262-137149284 TGAGTCCCTCCCACAACACGAGG + Intergenic
981676187 4:147345723-147345745 TGGGTCCCTTCCACAACACGTGG - Intergenic
981918174 4:150057412-150057434 TGGATCCCTCCCACAACATGTGG - Intergenic
982449589 4:155536620-155536642 TGGCTCCCTTCCACAACATGTGG - Intergenic
982888573 4:160817993-160818015 TGAGTCCCTCCCACAACATGTGG - Intergenic
982968755 4:161950992-161951014 TGGGTCCCTTCCACAACATGTGG - Intronic
983291209 4:165808542-165808564 TGGATCCCTCCCACAACAAGTGG - Intergenic
983699753 4:170577933-170577955 TGGGCCCCTCCCACAACACGTGG + Intergenic
985183866 4:187295658-187295680 TGAGTCCCTTCCACAACACATGG + Intergenic
985807642 5:2058978-2059000 TGGATCCCTCCCACAACATGTGG + Intergenic
985844242 5:2332377-2332399 TGGGTCCCTCCCACAACAGGTGG + Intergenic
986061520 5:4196125-4196147 TGAACCCGTTGCCAAACAGGCGG - Intergenic
986141310 5:5033219-5033241 AGATCCCCTTCCAGAACAGAAGG - Intergenic
986179221 5:5377847-5377869 CGAGTCCCTTCCACAACATGTGG - Intergenic
986356037 5:6927301-6927323 TGGGTCCCTCCCACAACAGGTGG + Intergenic
986615360 5:9611987-9612009 TGGGCCCCTCCCACAACATGTGG - Intergenic
986637329 5:9836002-9836024 TGGGTCCCTCCCACAACAGGTGG - Intergenic
986907883 5:12518315-12518337 TGGGCCCCTCCCACAACATGTGG + Intergenic
986938487 5:12920018-12920040 TGAACCCCTACCTTAACTGGAGG + Intergenic
987655588 5:20801169-20801191 TGGATCCCTCCCACAACAGGTGG - Intergenic
988767965 5:34402724-34402746 TGGGTCCCTCCCACAACAGGTGG + Intergenic
988796605 5:34657358-34657380 TGAGCCCCCTCCACAAAAGGGGG - Intronic
989656644 5:43752629-43752651 TGGGCCCCTCCCACAACATGTGG + Intergenic
989979084 5:50620950-50620972 TGGGCCCCTCCCACAACATGTGG - Intergenic
990359056 5:54999226-54999248 TGAATCCCTCCCACAACACGTGG - Intronic
991671668 5:69054405-69054427 ACAACCCCTTCCCCAACAAGGGG + Intergenic
992082501 5:73248299-73248321 TGGATCCCTCCCACAACATGTGG - Intergenic
992779296 5:80113767-80113789 TGGCCCCCTCCCACAACATGTGG + Intronic
993211077 5:84951948-84951970 TGGGTCCCTCCCACAACAGGTGG + Intergenic
993791131 5:92212591-92212613 TGAGTCCCTCCCACAACATGTGG + Intergenic
994145853 5:96393927-96393949 TGAAACACTTCCACAGCAGTTGG - Intronic
994416978 5:99484570-99484592 TGGGTCCCTCCCACAACAGGTGG - Intergenic
994462996 5:100090604-100090626 TGGGTCCCTCCCACAACAGGTGG + Intergenic
994989030 5:106975285-106975307 TGTGTCCCTTCCACAACACGTGG + Intergenic
995807931 5:116075254-116075276 TGAGTCCCTCCCACAACATGAGG - Intergenic
996011410 5:118484805-118484827 TGGGTCCCTCCCACAACAGGTGG + Intergenic
996973896 5:129407740-129407762 TGAGTCCCTTCCACAAAATGTGG - Intergenic
997003747 5:129794007-129794029 TCAACCCCTTTCACAATAGCTGG - Intergenic
997057470 5:130460981-130461003 TGGGCCCCTCCCACAACATGTGG - Intergenic
998989834 5:147803299-147803321 TGAGTCCCTCCCACAACACGTGG - Intergenic
1000648302 5:163784975-163784997 TGGATCCCTCCCACAACATGTGG + Intergenic
1001156354 5:169275759-169275781 TGGGTCCCTTCCACAACAGGTGG + Intronic
1001515479 5:172352599-172352621 TGAGTCCCTCCCACAACATGTGG - Intronic
1001811919 5:174635520-174635542 GGATCCCCGTCCAAAACAGGTGG + Intergenic
1002372119 5:178763178-178763200 TGAACTTCTTGCCCAACAGGAGG - Intergenic
1003006507 6:2387476-2387498 CGGGCCCCTCCCACAACAGGTGG - Intergenic
1003641643 6:7880176-7880198 TGAACCTGTTCCAAAACAGAAGG - Exonic
1003986489 6:11441209-11441231 TGGGTCCCTTCCACAACACGCGG - Intergenic
1004676227 6:17845238-17845260 TGAGTCCCTCCCACAACACGTGG + Intronic
1008025732 6:46634104-46634126 TGGATCCCTACCACAACATGTGG - Intronic
1008459715 6:51753868-51753890 TGAACAGCTTCCACAGCAGTGGG + Intronic
1009309758 6:62135142-62135164 TGGGTCCCTCCCACAACAGGTGG - Intronic
1011642034 6:89424740-89424762 TGGGCCCCTCCCACAACACGTGG + Intergenic
1012045035 6:94263126-94263148 TGGATCCCTCCCACAACATGTGG + Intergenic
1012169325 6:95999238-95999260 CGGGTCCCTTCCACAACAGGTGG + Intergenic
1012826508 6:104152772-104152794 TGCATCCCTCCCACAACATGTGG + Intergenic
1013077146 6:106781524-106781546 TGGGTCCCTTCCACAACATGTGG - Intergenic
1013535741 6:111061662-111061684 TGGGCCCCTCCCACAACACGTGG + Intergenic
1014219054 6:118781684-118781706 TGAACCCTTTCCCAAAGAGGTGG - Intergenic
1015044802 6:128764215-128764237 TGCATCCCTCCCACAACATGTGG + Intergenic
1015496469 6:133888996-133889018 TAGACCCCTTTCACAACCGGAGG - Intergenic
1015831620 6:137376273-137376295 TGAGTCCCTTCCACAACACAAGG - Intergenic
1016216411 6:141608725-141608747 TGGATCCCTCCCACAACATGTGG - Intergenic
1017204534 6:151790460-151790482 TGAACCCCTTCCACAACAGGTGG - Intronic
1017313245 6:152999573-152999595 TGGGTCCCTCCCACAACAGGTGG - Intronic
1017583508 6:155894269-155894291 TGGGCCCCTCCCACAACACGTGG + Intergenic
1018571710 6:165217989-165218011 TGGATCCCTCCCACAACACGTGG + Intergenic
1018622372 6:165742800-165742822 TGAACCCCTCCCTCAGCAGTGGG - Intronic
1020841753 7:13226454-13226476 AGGATCCCTTCCACAACATGTGG - Intergenic
1020870056 7:13617477-13617499 TGGATCCCTCCCACAACATGTGG - Intergenic
1021624561 7:22579972-22579994 TGGGTCCCTTCCACAACATGTGG + Intronic
1021882631 7:25109315-25109337 TGGGTCCCTTCCACAACATGTGG - Intergenic
1022397323 7:30000922-30000944 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1022701829 7:32768654-32768676 TGGGTCCCTTCCACAACACGTGG + Intergenic
1022906060 7:34858812-34858834 TGGGTCCCTTCCACAACATGTGG + Intronic
1022966110 7:35473873-35473895 TGGATCCCTCCCACAACACGTGG - Intergenic
1023801470 7:43838784-43838806 TGAAGCCCTTCCTCTACTGGGGG + Intergenic
1023966183 7:44964139-44964161 TGAACCGCTTCCACAAGATCCGG - Exonic
1024814972 7:53257630-53257652 TGAGTCCCTCCCACAACACGTGG - Intergenic
1026119983 7:67528718-67528740 TGCATCCCTCCCACAACACGTGG + Intergenic
1026321010 7:69267635-69267657 TGGATCCCTCCCACAACATGTGG + Intergenic
1026360985 7:69600209-69600231 TGCACCCCCTCCACAGCAGATGG + Intronic
1027835726 7:83238981-83239003 CGGACCCCTCACACAACAGGTGG + Intergenic
1028083904 7:86613827-86613849 TGAGTCCCTTCCACAACACGTGG - Intergenic
1028273677 7:88824242-88824264 TGGGTCCCTTCCACAACATGTGG - Intronic
1028957638 7:96712029-96712051 TGAGTCCCTCCCACAACATGTGG - Intergenic
1029304942 7:99612177-99612199 TGGGCCCCTCCCACAACACGTGG + Intergenic
1030806671 7:113928596-113928618 TGAGTCCCTCCCACAACACGTGG - Intronic
1030938601 7:115617153-115617175 TGGATCCCTTCCACAACATGTGG + Intergenic
1030970184 7:116046305-116046327 TGGGTCCCTTCCACAACATGTGG - Intronic
1031055770 7:116991577-116991599 TGACACCCTCCCACAACACGTGG + Intronic
1031174902 7:118338038-118338060 TGGATCCCTCCCACAACACGTGG - Intergenic
1031175176 7:118339950-118339972 TGAATCCCTCCCACAACACATGG - Intergenic
1032432239 7:131871597-131871619 TGAGTCCCTCCCACAACATGTGG + Intergenic
1032646906 7:133834850-133834872 TGGTTTCCTTCCACAACAGGTGG - Intronic
1032728324 7:134613039-134613061 TGGGCCCCTTCCACAACATGTGG + Intergenic
1032774880 7:135101841-135101863 GGAATCCCTCCCACAACATGTGG - Intronic
1032859157 7:135861387-135861409 TGGGTCCCTTCCACAACATGTGG + Intergenic
1033136458 7:138788678-138788700 TGAGTCCCTCCCACAACAAGTGG - Intronic
1034096072 7:148409017-148409039 TTAACCCCATGCACAACTGGTGG - Intronic
1034761684 7:153678683-153678705 GGAACCTCTTCCACCACAGAGGG - Intergenic
1034762996 7:153690967-153690989 TGGGCCCCTCCCACAACACGTGG + Intergenic
1034919046 7:155064255-155064277 TGGCTCCCTTCCACAACATGTGG - Intergenic
1035840669 8:2809407-2809429 TGGGTCCCTCCCACAACAGGTGG + Intergenic
1036517470 8:9458158-9458180 TGGCCCCCTACTACAACAGGTGG - Intergenic
1036914420 8:12790962-12790984 TGGGTCCCTTCCACAACAAGTGG + Intergenic
1037167252 8:15846113-15846135 TGAGTCCCTCCCACAACATGTGG + Intergenic
1037272187 8:17142315-17142337 TGGGCCCCTCCCACAACACGTGG + Intergenic
1037315846 8:17598738-17598760 TGGGCCCCTCCCACAACATGTGG - Intronic
1037358007 8:18043229-18043251 TGGATCCCTCCCACAACATGTGG + Intergenic
1037943107 8:22969286-22969308 CGAGTCCCTTCCACAACATGTGG + Intronic
1038000995 8:23391115-23391137 TGGGTCCCTTCCACAACATGTGG + Intronic
1038842663 8:31200393-31200415 TGGATCCCTCCCACAACACGTGG - Intergenic
1040617584 8:49053782-49053804 TGGGTCCCTTCCACAACATGTGG + Intergenic
1040762501 8:50867120-50867142 TGGGTCCCTTCCACAACACGTGG - Intergenic
1040972570 8:53152927-53152949 CCAAACCCTCCCACAACAGGTGG - Intergenic
1040997679 8:53418402-53418424 TGGATCCCTCCCACAACATGTGG - Intergenic
1041351532 8:56952260-56952282 TGGGCCCCTCCCACAACATGTGG + Intergenic
1042923318 8:73941042-73941064 TGAGTCCCTCCCACAACACGTGG - Intronic
1043680934 8:83023544-83023566 TGGGTCCCTTCCACAACATGTGG + Intergenic
1044010235 8:86985013-86985035 TGGATCCCTCCCACAACATGTGG - Intronic
1044045850 8:87430990-87431012 TGGATCCCTCCCACAACATGTGG - Intronic
1044072858 8:87784422-87784444 TGGATCCCTCCCACAACACGTGG + Intergenic
1045093257 8:98769289-98769311 TGAGTCCCTACCACAACAGGTGG - Intronic
1045588053 8:103562052-103562074 TGAATCCCTCCCACAACATGTGG + Intronic
1046052771 8:109043885-109043907 TGAGTCCCTTCCACAACCCGTGG + Intergenic
1046243631 8:111531378-111531400 TGGGCCCCTCCCACAACACGTGG + Intergenic
1046272369 8:111914009-111914031 TGGGCCCCTCCCACAACACGTGG - Intergenic
1046640320 8:116722109-116722131 TGAGTCCCTCCCACAACATGTGG - Intronic
1047240352 8:123081868-123081890 TGGGCCCCTCCCACAACATGTGG + Intronic
1047562749 8:126007421-126007443 TGGATCCCTCCCACAACATGGGG + Intergenic
1048158717 8:131991272-131991294 TGTGTCCCTCCCACAACAGGTGG + Intronic
1048737028 8:137513298-137513320 TGAGTCCCTCCCACAACACGTGG - Intergenic
1048806383 8:138245365-138245387 TGGATCCCTCCCACAACATGTGG - Intronic
1048915977 8:139182900-139182922 TGAATCCCTCCCACAATATGTGG - Intergenic
1049076434 8:140399896-140399918 TGGATCCCTCCCACAACATGTGG - Intronic
1051070193 9:13156600-13156622 AGGGCCCCTTCCACAACATGTGG + Intronic
1051726789 9:20095985-20096007 TGGGTCCCTTCCACAACATGTGG + Intergenic
1051829427 9:21258730-21258752 TGGGTCCCTTCCACAACATGTGG - Intergenic
1054999786 9:71436024-71436046 TGGATCCCTCCCACAACATGTGG - Intronic
1055857804 9:80712141-80712163 TGATTCCCTCCCACAACATGTGG - Intergenic
1058724436 9:107788509-107788531 TGGACCCCTCCCACAACACGTGG - Intergenic
1058884062 9:109309809-109309831 TCAACCCCATCAACAACTGGGGG + Intronic
1059570275 9:115426828-115426850 TGGATCCCTCCCACAACATGTGG - Intergenic
1062617142 9:137403004-137403026 TGGGTCCCTCCCACAACAGGTGG + Intronic
1203635569 Un_KI270750v1:107321-107343 TGGATCCCTCCCACAACATGTGG + Intergenic
1185716541 X:2347369-2347391 TGGGTCCCTCCCACAACAGGTGG + Intronic
1185893761 X:3841549-3841571 TGAGTCCCTCCCACAACACGTGG - Intronic
1185898876 X:3879973-3879995 TGAGTCCCTCCCACAACACGTGG - Intergenic
1185903993 X:3918402-3918424 TGAGTCCCTCCCACAACACGTGG - Intergenic
1186125361 X:6408162-6408184 TGGGCCCCTCCCACAACATGTGG + Intergenic
1186267942 X:7852005-7852027 TGAGTCCCTCCAACAACAGGTGG + Intergenic
1186355696 X:8787684-8787706 TGAACCCCTTCCCCAGCACACGG + Intergenic
1187301020 X:18050032-18050054 TGGGTCCCTTCCACAACATGTGG - Intergenic
1188889026 X:35586750-35586772 TGGGCCCCTCCCACAACATGTGG + Intergenic
1188912520 X:35866850-35866872 TGAGCCCCTCCCACAACACGTGG - Intergenic
1191116566 X:56858900-56858922 TGGGACCCTTCCACAACATGTGG + Intergenic
1191812231 X:65201784-65201806 TGGACCCCTCCCACAACATGTGG - Intergenic
1192846131 X:74908791-74908813 TGAGTCCCTCCCACAACATGTGG - Intronic
1193460663 X:81787668-81787690 TGGTTCCCTCCCACAACAGGTGG + Intergenic
1193503435 X:82309412-82309434 TGGATCCCTCCCACAACATGTGG + Intergenic
1194259911 X:91681793-91681815 TGGCTCCCTTCCACAACACGTGG + Intergenic
1194882230 X:99268103-99268125 TGAACCCCTTTTACAATAGCTGG - Intergenic
1195450804 X:105010285-105010307 TGAAACCCTTGCACCACAGTAGG - Intronic
1195880564 X:109588659-109588681 TGGGTCCCTTCCACAACATGTGG - Intergenic
1196055529 X:111351043-111351065 TGAGTCCCTTCCACAACATGTGG + Intronic
1196545374 X:116958378-116958400 TGAGTCCCTCCCACAACAGGTGG - Intergenic
1197054403 X:122098756-122098778 AGAGCCCCTTCCACAACATGTGG - Intergenic
1198173478 X:134130867-134130889 TAAACCCCTTCCATTATAGGTGG - Intergenic
1199042104 X:143126224-143126246 TGGATCCCTCCCACAACATGTGG - Intergenic
1199113149 X:143958672-143958694 TGGGTCCCTTCCACAACATGGGG + Intergenic
1199113428 X:143960591-143960613 TGAATCCCTTGCACAACACGTGG + Intergenic
1200040180 X:153359338-153359360 TGAGTCCCTGCCACAACATGTGG - Intronic
1200578609 Y:4920983-4921005 TGGCTCCCTTCCACAACATGTGG + Intergenic
1201693712 Y:16799550-16799572 TGGGTCCCTCCCACAACAGGTGG + Intergenic